19.01.2022

Какие витамины отвечают за рост волос: Витамины для волос: зачем нужны и как их выбрать

Содержание

самые главные элементы для укрепления

Если ты хочешь роскошную гриву как у Златовласки, то читай нашу статью о самых важных витаминах для роста волос.

Выпадение волос — одна из самых распространенных проблем, с которыми сталкиваются женщины. Причин у этого недуга может быть много: от недостатка сна до неправильного ухода. Скрытой причина, о которой многие не догадываются, является нехватка витаминов, которая может привести к осыпанию локонов. Вот самые главные витамины, которые вернут здоровье твоим волосам и заставят их расти как на дрожжах.

Витамин А

Этот витамин регулирует синтез ретиноевой кислоты в волосяном фолликуле. Он не только полезен для ухода за кожей, но и помогает в росте волос, потому что увлажняет волосы и сохраняет их здоровыми. Достаточное потребление витамина А приводит к оптимальной выработке кожного сала, что способствует увлажнению кожи головы для здорового роста волос. Найти ты его можешь в:

  • моркови
  • шпинате
  • других темных листовых зеленых овощах
  • тунце
  • сладком красном перце
  • манго

Витамин В12

Он играет жизненно важную роль в образовании эритроцитов, которые переносят кислород ко всем тканям организма, включая волосы. Исследования показывают, что существует потенциал для оптимального роста волос, если уровень витамина В12 находится в пределах нормы.

Продукты, богатые витамином B12:

  • Сыр
  • Молоко
  • Йогурт

Биотин

Биотин известен как «витамин роста волос». Это один из 12 витаминов в семействе витаминов группы В.

Было проведено исследование для оценки эффективности биотина в росте волос. Результаты показали, что у 18 пациентов с плохим ростом волос и ногтей наблюдалось улучшение после приема биотина. Дефицит этого витамина может стать причиной истончения волос и их выпадения волос.

Продукты, богатые биотином:

  • Грибы
  • Авокадо
  • Яйца
  • Арахисовое масло
  • Семена подсолнечника
  • Цветная капуста
  • Малина
  • Бананы
  • Грецкие орехи
  • Миндаль

Фолиевая кислота

Фолат является водорастворимым витамином В.

Он помогает генерировать эритроциты, которые обеспечивают транспортировку кислорода ко всем тканям, в том числе тем, которые отвечают за рост волос. Он восстанавливает клетки волосяного фолликула и предотвращает выпадение.

Продукты, богатые фолатом:

  • Капуста
  • Шпинат
  • Спаржевая фасоль
  • Салат
  • Брюссельская капуста
  • Зеленый горошек
  • Белые бобы
  • Спаржа
  • Свекла

Витамин С

Этот витамин помогает организму усваивать железо из пищи, что очень важно для роста волос. Он также способствует выработке коллагена, который необходим для поддержания структуры волос и устранения повреждений. Витамин С содержится в:

  • Шпинате
  • Темно-зеленых листовых овощах
  • Болгарском перце
  • Брокколи
  • Киви
  • Апельсинах
  • Лимонах
  • Горохе

Витамин D

Этот витамин стимулирует волосяной фолликул и клетки, так что они образуют новые стержни волос. Витамин D содержится в:

  • Рыбе
  • Устрицах
  • Масле печени трески
  • Тофу
  • Яйцах
  • Грибах

Витамин Е

Он стимулирует капилляры, что улучшает кровообращение в коже головы. Он также способствует росту волос благодаря богатому содержанию антиоксидантов и противовоспалительным свойствам.

Было проведено исследование для изучения влияния витамина Е на 21 человека с выпадением волос. Результаты показали, что в конце 8-месячного испытательного периода количество волосков у участников значительно увеличилось. Это связано с тем, что антиоксидантная активность токотриенолов помогает снизить окислительный стресс в коже головы.

Витамин Е содержится в:

  • Шпинате
  • Тофу
  • Авокадо
  • Миндале
  • Семенах подсолнечника
  • Оливковом масле
  • Брокколи
  • Тыкве

Тема, которая регулярно всплывает — выпадения волос., — 6863151

В каких витаминах нуждаются волосы?

Прежде всего, для роста волос организм нуждается в витаминах группы В: В1 (тиамин), В2 (рибофлавин), В6 (никотиновая кислота, пантотеновая кислота, пиридоксин), В7 (биотин), В8 (инозит), В9 (фолиевая кислота), В12 (цианокобаламин). Витамины этой группы отвечают за рост волос, их дефицит может привести к выпадению волос. Также витамины группы В делают волосы прочными, эластичными и блестящими.

Свое влияние на рост и состояние волос оказывают витамины А (ретинол, бета-каротин), Е (токоферол), С (аскорбиновая кислота). При недостатке этих витаминов волосы начинают выпадать, становятся тусклыми, ломкими, начинают сечься.

Помимо витаминов, для красоты и здоровья волос необходимы микроэлементы: магний, кремний, молибден, сера, железо, цинк, селен, фосфор.

Сегодня существует множество витаминных комплексов, направленных на предотвращение выпадения волос и стимуляцию их роста, однако, СИНТЕТИЧЕСКИЕ ВИТАМИНЫ СКОРЕЕ ВРЕДНЫ, ЧЕМ ПОЛЕЗНЫ ДЛЯ ОРГАНИЗМА.

Вред синтетических витаминов

Почему искусственные витамины вредны для организма? Дело в том, что в формуле любого природного, натурального витамина есть частица белкового основания, которых  нет в искусственных витаминах. Искусственные витамины – это «мертвые» вещества. В процессе получения химических витаминов искусственным путем, их переводят из органической структуры в кристаллическую, а это по своей сути неорганическая структура, которая не расщепляется и не усваивается человеческим организмом, а потому не несет никакой пользы. К тому же, химические вещества, которые содержатся в витаминных комплексах, накапливаются организмом и способны нанести большой вред. При приеме искусственных витаминов создается повышенная нагрузка на почки и печень, нарушается необходимый баланс в организме. Особенно вредны синтетические витамины, если употреблять их в повышенной дозировке. При передозировке искусственных витаминов возможны серьезные проблемы со здоровьем – от нарушения обмена веществ и аллергических реакций до тяжелой интоксикации , чего никогда не будет, если получать много витаминов из натуральной пищи. Переесть натуральных витаминов, вообще, весьма трудно.

Из вышеописанного следует вывод: ВИТАМИНЫ СЛЕДУЕТ ПОЛУЧАТЬ ТОЛЬКО ИЗ НАТУРАЛЬНЫХ ПРОДУКТОВ. Ниже мы рассмотрим, в каких продуктах содержится больше всего витаминов, необходимых для роста и укрепления волос.

Витамины для роста и укрепления волос в продуктах питания

Чтобы обеспечить организм витаминами группы В, необходимо включить в рацион такие продукты, как зерновые проростки (например, пророщенная пшеница), крупы (гречка, овсянка), хлеб грубого помола, бобовые (фасоль, горошек), семечки, орехи (грецкие, миндальные, фундук; наибольшую пользу принесут нежареные орехи и семечки), кефир, творог, сыр, морковь, капуста. Высокое содержание витаминов группы В имеют пивные дрожжи, однако, с дрожжами следует быть осторожно, т.к. они приводят к увеличению массы тела.

Больше всего витаминов группы В содержится в пророщенных злаках. 100 г пророщенной пшеницы в день покрывает потребность организма во всех необходимых витаминах кроме витамина В12. Пророщенная пшеница является кладезем витаминов и микроэлементов, необходимых для красоты и здоровья волос. Регулярное употребление пророщенной пшеницы  предотвращает выпадение волос, делает их густыми и сильными, ускоряет рост,  препятствует преждевременному появлению седины.

Потребность организма в витамине А обеспечат зеленые и желтые фрукты и овощи: морковь, абрикосы, крыжовник, петрушка и др.  Рекордсмен по содержанию витамина А – морковь. 1-2 моркови или ? морковного сока покрывает ежедневную потребность организма в этом витамине. Употребление моркови  укрепляет волосы, делает их прочными и  эластичными,  помогает противостоять воздействию ультрафиолета.

Витамин Е содержится в семечках, орехах. Наиболее богато содержанием витамина Е растительное масло холодного отжима (соевое, льняное, подсолнечное, оливковое, кукурузное). 1 ст. л. подсолнечного масла покрывает ежедневную потребность организма в витамине Е.  Употребление растительного масла способствует укреплению волос, делает волосы упругими и блестящими.

Витамин С можно получить из шиповника, капусты (особенно высоко содержание витамина С в квашенной капусте), болгарского перца, черной смородины, киви, цитрусовых. Регулярное употребление продуктов, содержащих витамин С, улучшает циркуляцию крови и поступление полезных веществ к волосяным луковицам. Вопреки расхожему заблуждению, больше всего витамина С содержится не в цитрусовых, а в сушеных плодах шиповника. В 10 г шиповника содержится суточная потребность в витамине С.

🙂

Микроэлементы для роста волос

• Цинк и медь – предотвращают облысение и способствуют быстрому росту волос. Содержатся в креветках, бобах, печени, грецких орехах и купах.

• Железо – делает волосы более крепкими, предотвращая ломкость. Им богаты печень, желтки и орехи.

• Сера – укрепляет стержень волоса и улучшает цвет. Содержится в чесноке, рыбе и печени.

• Молибден – ускоряет рост волос. Им богаты какао, печень и почки животных, горох.

• Кремний – делает волосы упругими и сильными, улучшает их рост. Им богаты крупы и корнеплоды.

• Метилсульфонилметан (MSM) – это новое необычайно эффективное вещество, которое прописывают для быстрого роста волос и их восстановления.

🙂

Для тех, кто всё-же предпочитает синтетичские витамины:

• Inneov Густота волос, Vichy – ускоряет рост волос и помогает при выпадении, в целом хорошо оздоравливает волосы.

• Перфектил – популярный витаминный комплекс, предназначенный для лечения алопеции (облысения), создан для ускорения роста волос. Однако есть у него один минус – у многих девушек Перфектил вызывает тошноту. Поэтому принимать его нужно только на полный желудок.

• Пантовигар – помогает при выпадении и повреждении волос химическими веществами и солнечным излучением.

• Нутрикап – хорошо ускоряет рост волос, предотвращает выпадение и придает блеск.

• Витрум Бьюти – лично я пью эти витамины для роста волос уже третий год с перерывами на другие препараты, для того чтобы организм не привыкал. Это не значит, что они самые лучшие, просто тот эффект который мне дал Витрум Бьюти, поразил меня на столько, что эти витамины стали любимыми.

• Фемикод – это еще одни мои любимые витамины, которые я пью в перерыве между Витрумом. У этой марки есть специальные витамины для волос и ногтей. Но я предпочитаю пить комплекс Бьюти-тонус, так как их состав намного богаче и полезней для волос.

• Мерц Бьюти – это драже для поврежденных волос, которое помогает вернуть блеск и красоту волос. Влияния на рост я не заметила. Но есть много положительных отзывов об этом препарате.

• Фитофанер от Phyto – достаточно хорошие витамины, которые укрепляют волосы и стимулируют рост.

• Фитовал – делает волосы толще, восстанавливает и ускоряет их рост за счет активного поступления необходимых веществ к корням волос.

• Пивные дрожжи – это достаточно универсальные витамины, которые хорошо отражаются на состоянии волос. По отзывам девушек самыми лучшими считаются Нагипол и Эвисент.

• Цинктерал – достаточно эффективные витамины для роста волос, правда, пить их нужно по назначению врача. Очень эффективен при лечении облысения.

• Биотин – эти витамины для волос выпускаются под разными марками, но имеют одинаковый состав – витамин Н, который также называют витамином красоты.

 

Витамины для роста волос и их здоровья

Многие люди страдают проблемой выпадения волос, но ещё большее количество людей желают, чтобы рост их волос происходил быстрее, чем есть на данный момент.
Причин, по которым люди желают быстрого роста волос, достаточно много и у всех они разные.

Но, как бы там ни было, такая проблема существует и её можно решить.
Профессиональные парикмахеры расскажут какие витамины нужны для роста волос и поддержания их здоровья

Витамины для роста волос и их здоровья

1. Все витамины группы В. Витамины этой группы способствуют усиленному росту волос, укрепляют их структуру, влияют на регуляцию жирности и наполняют блеском и энергией. Содержаться в бобовых культурах, отрубях, яйцах, пивных дрожжах.

2. Витамин В6 или пиридоксин. Предназначение витамина отвечать за цвет волос, воздействует на выработку меланина в организме. Взаимодействие с другими группами витаминов, помогает в сохранении защитного слоя фолликул, способствует быстрому росту волос. Пиридоксин содержится в крупах из необработанного зерна, мясных деликатесах, картофеле, бананах.

3. Ниацин известный как витамин В3. Один из главных поставщиков кислорода в клетки кожи головы, тем самым способствует насыщению питательными веществами и обогащению важной составляющей организма. Найти ниацин можно в рыбе, курице и зародышах пшеницы.

4. Витамин B5 или пантотенат кальция. Препятствует появлению седых волос и при частом выпадении волос поможет их укреплению (рекомендуем почитать про народные средства против выпадения волос, которые помогут сохранить вашу шевелюру). Для пополнения запасов витамина важно употреблять в пищу цельные зёрна, кисломолочные продукты, зелень, арахис, индейку, отруби, овсяные хлопья.

5. Витамин В9 или фолиевая кислота. Содержание в организме фолиевой кислоты прямо пропорциональному быстрому росту волос. В9 формирует новые клетки не только фолликул волос, но и кожи, а если сочетать его употребление с витамином В5, можно надолго забыть о седине.

6. Биотин или витамин Н. Ещё один витамин, дефицит которого ведёт к облысению (если вас беспокоит такая проблема, то читайте про способы лечения облысения у мужчин) и седине. Без участия биотина невозможно производство кератина, отвечающего за внешний блеск и яркость волос. Пищевыми источниками являются цельное зерно, отварной рис, молочные продукты, дрожи пивные и варёное яйцо.

7. Токоферол — витамин Е. Способен за короткий срок применения восстанавливать гиподинамику кожи головы, подпитывать луковицы волос, оберегать от солнечных лучей и значительно укрепить структуру волос. Витамин Е в большом количестве содержат все виды растительных масел, яичный желток, крупы, семечки, зелёные листовые овощи.

8. Ретинол или витамин А. Нередко аксерофтол (витамин А) называют главным стимулятором роста. При длительном приёме хорошо влияет на рост волос, благотворно воздействуя на их структуру, придавая мягкость и шелковистость. Ретинол помогает устранить сухие кончики волос, активно борется с секущимися концами (из наших полезных советов вы узнаете, как можно предотвратить сечение волос), при этом восстанавливая эластичность шевелюры. Чтобы восполнить недостаток витамина в организме, нужно употреблять в пищу масло сливочное, куриные яйца, печёнку, молочные продукты, морковку, зелень, абрикосы и отвар шиповника.

9. Аскорбиновая кислота или витамин С. Один из главных строительных кирпичиков иммунной системы, который непросто питает защитные силы организма, но и способствует восстановительному процессу.
Рост волос невозможен без содействия витамина С, так как аскорбинка улучшает кровообращение. Кстати, витамин С помогает усваивать железо, которое играет одну из главных ролей в создании энергетических запасов организма. Найти витамин можно в цитрусовых, чёрной смородине, киви, квашеной капусте.

Минеральные вещества и микроэлементы для роста волос

Не забываем о важности приёма минеральных веществ и микроэлементов для усиленного роста и здоровья волос. Ниже представлены самые важные из них, которые отвечают за формирование новых клеток и внешнего блеска волос.

• Магний – отвечает за гибкость волос.
• Кремний — входит в состав коллагена волос, его наличие влияет на прочность волос.
• Цинк — воздействует на внешнюю структуру предотвращая появление так называемого «инея» в волосах.
• Фосфор — отвечает за формирование цвета волос.
• Кальций – способствует появлению новых фолликул, препятствует выпадению.
• Сера — насыщает волосы зеркальным сиянием.

Кроме вышеперечисленных методов, благоприятное воздействие на волосы могут оказать косметические процедуры оздоровления, которые вы всегда можете провести с помощью профессиональной косметики для волос

Какие средства для быстрого роста волос на голове

Ключевые теги: сновидения выпадение волос, лечебные маски от выпадения волос купить, дарсонваль лечение волос от выпадения.


Estel otium unique тоник активатор роста волос, чего втирать в корни волос для укрепления и роста волос, уколы для восстановление волос, estel otium unique тоник активатор роста волос, чем остановить выпадение волос при щитовидке.

Принцип действия

Особая формула маски с натуральными природными ингредиентами стимулирует рост волос, укрепляет волосы от корней до кончиков и предотвращает появление седины! Входящие в состав витамины и минералы блокируют избыток гормона дигидротестостерон, влияющий на потерю волос.

Маска для роста волос с яйцом. Очень часто встречаются домашние рецепты средств с яйцом. Эффект от использования этого средства для быстрого роста волос доказан при употреблении его мужчинами, которые страдали от облысения. Его наносили на проборы на голове у женщин. Оставляя свои контактные данные, вы подтверждаете свое совершеннолетие, соглашаетесь на обработку персональных данных в соответствии с правовой информацией


Официальный сайт Активатор роста волос

Состав

Общее понятие о таблетках для роста волос на голове у женщин, какие стоит применять? Одним из лучших естественных украшений являются густые, сильные и … Лучшие витамины для роста волос — топ эффективных. Применять витамины для роста волос нужно, но какие аптечные витамины действительно подходят для укрепления и роста волос? Какие средства обеспечивают рост и здоровье волос? 2. … Лучшие средства для роста волос. … Именно поэтому его применяют для усиления роста волос на голове. Препарат применяют в …

Результаты клинических испытаний

Маски для быстрого роста волос. Значительно ускорить рост волос помогут простейшие яичные маски для волос в домашних условиях. 1 желток или несколько (в зависимости от объема) наносится на волосы и аккуратно и … Быстрого роста волос в домашних условиях, если верить отзывам, легко добиться, нужно только набраться терпения. … Какие средства выбирать в магазинах … Как ускорить рост волос на голове … Рассмотрим самые эффективные народные средства от выпадения волос в домашних условиях.

Мнение специалиста

Стрессы и ежедневные переутомления, несбалансированное питание, изнуряющие диеты и нехватка витаминов негативно сказываются на организме. Зеркалом этих проблем становятся волосы. Достаточно лишь одного нервного дня и Ваши волосы будут Вас терять, а после недели стресса — оставаться целыми прядями на расчёске. Чтобы избежать облысения и предотвратить выпадение волос, рекомендую использовать маску Princess Hair.

5 лучших сухих шампуней. Современные производители косметических средств для очищения волос предлагают потребителю большое разнообразие сухих шампуней. Средства для роста волос на голове: какие признаны лучшими и почему. Когда волосы выпадают, плохо растут в длину, секутся на концах, это может быть временной реакцией на стресс, перенесенную инфекцию, гормональный сбой.

Способ применения

Нанесите маску на вымытые влажные волосы, распределите по всей длине, особое внимание уделяя коже головы Оставьте на 5-7 минут для воздействия Тщательно смойте водой. Рекомендуется использовать 2-3 раза в неделю

Название препарата: Фото Примерная цена DS Laboratories Spectral (Спектрал) DNC / Лосьон с миноксидилом 5% для улучшения роста волос 60 мл Длинные волосы — синоним изящности и женственности. Кому-то длинные волосы достались в подарок, а кто-то очень старается их отрастить. В этом помогут средства для быстрого роста волос. MissFit — интернет-журнал для женщин. Вас интересует питание беременных, развитие плода, похудение после беременности?

Как заказать?

Заполните форму для консультации и заказа Активатор роста волос. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении

Никотиновая кислота для волос: как отрастить волосы или не потерять нажитое?;) Мифы о том, можно ли с ее помощью быстро отрастить волосы на 10 см.)) Какие Витамины нужны для роста волос на голове?Совместимость витаминовСодержание в продуктах питанияСимптомы нехваткиАптечные Витаминные комплексыВитамины для роста волос в ампулахПередозировкаПолезные МатериалыПроблемы с волосами не возникают на пустом месте. Значит, организму чего-то не хватает. Возможно витаминов.Какие витамины способствуют росту волос? 1. Витамин А — помогает вырабатывать строительный материал для волос – кератин; 2. В1 и В12 — отвечают за здоровье стержня и фолликула, благодаря им локоны«становятся блестящими и густыми; 3. В6 — укрепляет волосяные луковицы и ускоряет рост; 4. С — способствует нормализации кровообращения в кож…See more on hairhomecare.ruТаблетки для роста волос на голове: лучшие витамины и …hairproblem.ru/19-tabletki-dlya-rosta-volos-na-golove.htmlЗапрещен прием этих таблеток для роста волос на голове во время беременности или при индивидуальной непереносимости компонентов средства. Цена …

Цена на восстановление волос, продукция от выпадения волос, inebrya от выпадения волос, средство от перхоти и выпадении волос, цена на восстановление волос, средство для роста волос из крапивы, восстановление волос креатиновое.
Официальный сайт Активатор роста волос

Купить Активатор роста волос можно в таких странах как:


Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина, Эстония, Латвия, Литва, Болгария, Венгрия, Германия, Греция, Испания, Италия, Кипр, Португалия, Румыния, Франция, Хорватия, Чехия, Швейцария, Азербайджан , Армения ,Турция, Австрия, Сербия, Словакия, Словения, Польша


Мы мужу такую маску заказывали, но у другого производителя, кучу денег отдали. Но это давно было, сейчас, я смотрю, цена более чем доступная. Но, сказать честно, за такой результат никаких денег не жалко!

Два месяца – это супер результат! Я годами борюсь с выпадением и толку ноль. Тоже теперь заказала маску и себе! Жаль, раньше ничегошеньки о ней не слышала.

Извиняюсь, не заметила на сайте сначала информацию про наложенный платеж. Тогда все в порядке точно, если оплата при получении. Пойду, оформлю себе тоже заказ.

СМИ об ИНВИТРО.

Самое естественное украшение от глубокой древности до наших дней, знак социального статуса, «игрушка» моды, отражение настроения и взглядов на мир… Пожалуй, ни одна деталь внешности не претерпела столько изменений за всю многовековую историю человечества. 

Парикмахеры советуют лучше ухаживать за волосами, психологи — жить в гармонии с собой, врачи — правильно питаться и лечить причину, а не следствие. 

Какие же рецепты красоты и здоровья сохранились до наших дней, и что дала нам в этом отношении современная цивилизация?

Рецепты по уходу с древнейших времен

Самый легендарный персонаж «женской» истории — Клеопатра, мудрая и прекрасная царица Египта. Кто не знает о ее молочных ваннах из ослиного молока и меда! По легендам, царица ухаживала за волосами с помощью яичных и глиняных масок, которые сделали ее красоту практически неподвластной времени. Кроме того, в Древнем Египте мыли волосы с помощью лимонной кислоты, используя как кондиционер миндальное, розмариновое или касторовое масла. В древней Индии и Китае широко применялись отвары душистых трав. 

В средние века список полезных для волос веществ пополнился новыми элементами. Рецепты лекарственных средств составлялись по принципу алхимических соединений, и, что удивительно, многие из них в самом деле обладали полезными свойствами. Эти магические зелья содержали самшит, слоновую кость, сожженных ящериц и змей, жир медведя, корень камыша и другие столь же экзотические компоненты. Многие открытия, актуальные до сих пор, сделаны итальянской женщиной-ученым — Тротулой. Небывалый случай: в XII веке женщина заведует кафедрой самой известной медицинской школы в Европе! Тротула оставила после себя труды о женских болезнях, о беременности, косметологические рецепты. В саду знаменитой школы в Салерно выращивалось более 300 видов растений. Большая часть из них используется в современной косметологической индустрии. 

Косметика наших дней

Природные средства — самый естественный уход. Все это актуально и для волос. Многие натуральные и «травяные» рецепты можно успешно использовать и в наши дни, например: 

Яичные маски. В яйце много витамина В3, или РР, который влияет на рост волос, насыщенность и яркость их цвета. 

Маски на основе меда. Мед очень полезен — в нем содержатся витамины В, РР, С, H, Е и К, которых может не хватать волосам. Мед можно смешать с яйцом, лимонным соком, репейным маслом. Маски наносятся на волосы на 15-20 минут, затем смываются водой и нейтральным шампунем. 

Кислое молоко. Кефир или простокваша придают волосам блеск, помогают при выпадении волос, увлажняют сухие волосы и «обезжиривают» жирные. Важно, что кисломолочные продукты обволакивают волос тончайшей пленкой, защищающей от вредного воздействия окружающей среды. 

Репейное, облепиховое, миндальное масло, масло авокадо и т.д. Натуральные растительные масла содержат витамины и жирные кислоты, не синтезируемые в организме человека. Масло наносится на волосы, как маска, а после смывается водой и шампунем. 

Настой крапивы, отвар из березовых листьев и т.д. Крапива — самое распространенное средство для укрепления волос. Настой нужно втереть в кожу головы после мытья и не смывать. 

Натуральные рецепты действительно способны ухаживать за волосами, поддерживать их, сделать более послушными и блестящими. 

Однако прогресс не стоит на месте, и уже в начале ХХ века, когда Несслер изобрел первую машину для химической завивки, стало ясно, что натуральной «терапии» отныне недостаточно. Чтобы защитить волосы от воздействия химических составов и красок, косметологи разработали почти столько же средств для ухода за окрашенными и ослабленными химией волосами. Это специальные маски и сыворотки на основе компонентов, которые в домашних условиях добыть довольно трудно: это аминокислоты, керамиды (особые липидные молекулы), увлажняющие вещества, комплексы витаминов, хитозан (волокно из панциря ракообразных), таннины (растительные фенольные соединения), фруктовые кислоты, УФ-фильтры и многие другие элементы. 

Секреты медицины

Однако как натуральные, так и косметические средства — вовсе не «панацея» от всех бед. Недаром с глубокой древности косметология и медицина шли рука об руку! Гиппократ и Гален, Парацельс и Нострадамус подарили потомству как врачебные, так и косметические рецепты. 

Поэтому не торопитесь покупать дорогостоящие средства. Они могут быть эффективны, только если проблема — например, выпадение волос, — является временной и не носит системного характера. К временным причинам можно отнести ослабленность волос после химической завивки или покраски — в этом случае можно начать с лечебных масок для волос или специальных восстанавливающих сывороток. Если же причина лежит глубже, «поверхностные» решения не помогут. Появились «жалобы» на волосы? Следует посетить врача-трихолога. 

Врачи говорят: не бывает роскошной шевелюры у того, кто страдает какой-либо хронической болезнью. В конечном итоге, внешний вид волос зависит исключительно от внутреннего здоровья организма. 

А вот причин выпадения волос, отсутствия блеска и жирности кожи головы может быть множество: 

• гормональные нарушения (у женщин, в том числе выпадение волос после родов), 

• отягощенная наследственность (у мужчин), 

• иммунологические нарушения, обусловленные снижением общего и местного иммунитета, 

• заболевания (гепатопатиты, железодефицитная анемия, сахарный диабет), 

• стрессы и токсические факторы внешней среды, 

• прием некоторых препаратов, 

• недостаток или избыток жизненно важных микроэлементов. 

Поэтому перед первым посещением врача необходимо провести предварительное обследование, состоящее из эндокринологических и иммунологических исследований. В первую очередь желательно выяснить, правильно ли функционирует гормональная и желудочно-кишечная система, а также исследовать сам волос на избыток/недостаток необходимых микроэлементов. 

«Диета» для волос

Врачи рекомендуют: наилучший метод профилактики и лечения заболеваний волос — здоровый образ жизни и сбалансированное питание. Очень важно питаться правильно, а в зимне-весенний период — принимать нужные витамины. Для здоровья волос необходимы, прежде всего, витамины группы В (они есть в говядине, печени, кисломолочных продуктах, яйцах, орехах, кашах из недробленых круп). Именно эти витамины отвечают за рост волос. Также на волосах может сказаться дефицит витаминов А, С и Е. Они содержатся в свежих зеленых овощах, зелени, фруктах, бобовых, в яйцах, мясе и субпродуктах, натуральном коровьем молоке, твороге, кисло-молочных продуктах. 

Кроме того, для здоровья волос необходимы микроэлементы: 

Цинк. Он играет важнейшую роль процессах регенерации кожи, роста волос и ногтей, способствует всасыванию витамина Е, который в свою очередь полезен для волос. В организм микроэлемент попадает с пищей. Особенно много цинка в говядине, печени, морских продуктах, зародышах пшеничных, рисовых отрубях, овсяной муке, моркови, горохе, луке, шпинате, орехах. 

Селен. Этот микроэлемент способствует усилению иммунной защиты организма, стимулирует обмен веществ. Селен поддерживает структуру волос изнутри, обеспечивая насыщенный и стойкий цвет, предотвращает ломкость волос, при недостатке селена волосы начинают сильно выпадать. Естественным источником являются пищевые продукты: чеснок, свиное сало, пшеничные отруби, белые грибы, оливковое масло, морские водоросли, пивные дрожжи, маслины, кокосы, фисташки и кешью. 

Кремний. В различных соединениях микроэлемент входит в состав большинства тканей организма, влияет на обмен липидов и на образование коллагена. Кремний — «кормилец» волос, ногтей, кожи. Стимулирует рост волос. Поступает в организм с грубой растительной пищей (клетчатка), хрящами, питьевой водой. 

Магний. В организме микроэлемент выполняет большое количество функций. Дефицит магния приводит к усиленному выпадению волос. Поступает в организм с растительной пищей (бананы, картофель, соя, пророщенная пшеница), с поваренной солью и водой. 

Йод. Имеет опосредованное влияние на волосы, то есть при недостатке микроэлемента могут развиться заболевания щитовидной железы, которые и способствуют выпадению волос. Содержится йод в морепродуктах (треска, водоросли, пикша, палтус, сельдь, сардина, креветки), а также в применяемых в пищевой промышленности йодофорах и в йодированной соли. 

Несколько фактов о волосах

№1. Кто бы мог подумать, что больше всего на волосы влияет не шампунь, кондиционер, бальзам или сыворотка… а именно вода, которой волосы ополаскивают! Ведь волосы способны впитывать влагу, это обусловлено их структурой. При этом чем вода мягче, тем лучше. Конечно, вы слышали о полезных свойствах дождевой и снеговой воды. Они объясняются тем, что «природная» вода не содержит искусственных добавок, хлора, солей кальция и магния. Разумеется, в городе найти чистую дождевую воду или же снег не удастся. Зато вполне возможно «смягчить» водопроводную воду, профильтровав и прокипятив ее. Можно использовать специальные добавки. 

№2. Одно из самых эффективных средств для здоровья волос — массаж головы. Он стимулирует кровообращение и питание корней волос. Для этого можно использовать обычную расческу, но гораздо полезнее делать массаж руками. Сначала сделайте легкое растирание кромки роста волос пальцами рук, затем двигайтесь по радиусу от периферии к макушке и обратно. Пальцы во время массажа как бы рисуют кружочки, спирали или крестики. За ушной раковиной движения должны быть волнообразными. Длительность массажа — от 15 до 20 минут, минимум 1 раз в неделю. 

Дети и витамины

Дети и витамины

Витамины – один из самых важных компонентов питания ребенка. Они участвуют в обмене веществ, восстановлении тканей, нужны для роста, интеллектуального развития, иммунитета.

Как получить свою норму витаминов?

Некоторые витамины синтезируются в организме. Витамин D образуется в коже, а витамин В производится микрофлорой кишечника. Другие поступают с питанием. Но даже отменный аппетит и самые качественные продукты не могут полностью восполнить дефицит. Так, например, чтобы удовлетворить суточную потребность в витамине А, годовалый малыш должен съесть одно крупное яйцо или 400 граммов творога. Достаточное количество витамина С грудной ребенок получит со 100 граммами цитрусовых или 60 граммами зеленого лука. А чтобы получить норму витамина D, ребенка нужно каждый день держать полностью раздетым на солнце не менее 15 минут. Очевидно, что реализоваться такие «рекомендации» не под силу.

Кому показан дополнительный прием витаминов?

До сих пор считалось, что если дошкольник или школьник разнообразно питается, не соблюдает лечебную диету, то он не нуждается в дополнительных источниках витаминов. Однако качество пищи все больше подвергается сомнению. Удобрение, хранение, переработка продуктов снижает содержание в них полезных веществ.

Витамины в составе комплексов или по отдельности рекомендованы детям, которые:

— капризны в еде: не любят овощи, не едят мяса и т.п.;

— страдают пищевой аллергией на глютен, имеют непереносимость лактозы, белка коровьего молока и т.п.;

— имеют симптомы дефицита каких-либо витаминов;

— часто болеют инфекционными заболеваниями;

— имеют патологии, которые препятствуют усвоению веществ из пищи;

— подвергаются дополнительным физическим или умственным нагрузкам.

Витамины для жизни

Эти витамины играют жизненно важную роль в развитии ребенка от 1 до 3 лет.

Д (кальциферол)

Рост и развитие костной и мышечной тканей, накопление кальция и фосфора в костях. Развитие клеток кишечника, почек, работа сердца, участвует в синтезе некоторых гормонов.

Суточная норма: 10 мкг

А (ретинол)

Здоровье слизистых оболочек и кожного покрова. Работа пищеварительной, иммунной и выделительной систем. Рост костей, волос, зубов, отвечает за остроту зрения.

Суточная норма: 450 мкг

С (аскорбиновая кислота)

Эластичность стенок кровеносных сосудов, заживление ран, рост костей, зубов и волос. Образование и здоровье соединительной ткани. 

Суточная норма: 40 мг

Е (токоферол)

Антиоксидантные свойств, работа сердечно-сосудистой системы. Укрепляет стенки кровеносных сосудов и сердечную мышцу, участвует в усвоении других витаминов.

Суточная норма: 6 мкг

К (филлохинон)

Участвует в процессе свертывания крови, в обмене веществ костной и соединительной тканей.

Суточная норма: 15 мкг

Витамины группы В

Тканевое дыхание, выработка энергии, обмен углеводов, жиров, белков, процессы кроветворения. Необходимы для нормальной работы нервной системы и психического здоровья.

Суточная норма:

В1 – 0.7 мг

В2 – 0.8 мг

В3 – 9 мг

В5 – 3 мг

В6 – 1 мг

В7 – 10 мкг

В9 – 0.05 мг

В12 – 0.7 мкг

Перед приемом любых витаминов необходимо проконсультироваться с врачом.

витаминов от выпадения волос: работают ли они?

Подробнее

Если у вас есть какие-либо медицинские вопросы или опасения, обратитесь к своему врачу. Статьи в Health Guide основаны на рецензируемых исследованиях и информации, полученной от медицинских обществ и правительственных агентств. Однако они не заменяют профессиональные медицинские консультации, диагностику или лечение.

На протяжении всей истории существовали мифы о выпадении волос. В Древнем Египте врачи клялись, что смесь жира бегемота, крокодила и змеи изменит ситуацию — можно сказать, буквально змеиное масло.Позднее Гиппократ в качестве лекарства назначил местное применение голубиного помета.

Сегодня мы стали немного сложнее, но вымысел остался. Один из самых распространенных мифов заключается в том, что прием специально разработанных «витаминов для волос» может питать фолликулы и улучшать рост волос. Реальность такова: облысение по мужскому или женскому типу почти всегда вызвано биологическим процессом, с которым не могут повлиять витамины и пищевые добавки.

Давайте посмотрим, что говорит наука о том, какие витамины могут помочь при выпадении волос, а какие являются еще одним типом змеиного масла.

Лечение начинается от 20 долларов в месяц

Найдите подходящий план против выпадения волос.

Выучить больше

Существует длинный список витаминов и добавок, предназначенных для улучшения некоторых свойств ваших волос. Ваш дерматолог может даже купить немного в своем офисе. Будь то цинк, витамины группы В или фолиевая кислота — производителей нет недостатка в том, что их составы утолщают, укрепляют, сохраняют или даже отращивают волосы. Но большинство добавок не оправдывают этих обещаний.

В 2019 году исследователи рассмотрели 125 научных статей о витаминах и облысении. Они пришли к выводу, что данных для рекомендации многих витаминов и минералов, способствующих росту волос, включая цинк, рибофлавин, фолиевую кислоту, витамин B12, витамин E и биотин, недостаточно. Фактически, они предостерегали от использования биотина, который может изменить результаты конкретных анализов крови (Almohanna, 2019; FDA, 2019). Было обнаружено, что только витамин D и железо влияют на облысение по мужскому типу (андрогенетическая алопеция).Подробнее об этом через секунду.

Облысение по мужскому типу обычно вызывается ДГТ (дигидротестостероном), который обычно называют мужским половым гормоном, хотя он есть у каждого человека. У мужчин с генетической предрасположенностью ДГТ атакует волосяные фолликулы на голове, вызывая их усыхание. Это приводит к тому, что волосы становятся все более тонкими, что потенциально может привести к их отсутствию.

DHT является виновником выпадения волос почти у всех взрослых мужчин. В редких случаях в игру вступают другие причины, включая стресс, травмы или недостаток питания.

В обзоре Dermatology and Therapy за 2019 год исследователи рассказали о витаминах, которые, как известно, помогают при выпадении волос и способствуют здоровому росту волос:

Нет доказательств того, что витамин А может замедлить или остановить выпадение волос, а чрезмерное употребление его может фактически вызвать выпадение волос и повреждение кожи (Almohanna, 2019). Рекомендуемая суточная доза витамина А составляет 4300 МЕ. Высокие дозы витамина А могут быть токсичными, вызывая головные боли, проблемы со зрением и даже судороги.

Недостаток каких витаминов вызывает выпадение волос?

Есть тонна витаминов группы B — тиамин (B1), рибофлавин (B2), ниацин (B3), пантотеновая кислота (B5), витамин B6, биотин (B7), фолиевая кислота и витамин B12 — но они этого не делают. много от выпадения волос. Хотя витамины B выполняют в организме человека функции из списка A (они необходимы для выработки энергии и образования красных кровяных телец, и это лишь некоторые из них), нет никаких научных доказательств того, что они заставят вас отрастить больше волос.

Биотин, также известный как витамин B7, вероятно, является наиболее рекламируемой добавкой для роста волос. Но нет никаких доказательств того, что он действует при выпадении волос. Дефицит биотина может вызвать выпадение волос, кожную сыпь и ломкость ногтей, но у большинства людей с облысением дефицита биотина нет, поэтому добавки биотина не являются эффективным лечением (Almohanna, 2019).

На самом деле, прием добавок биотина, когда в этом нет необходимости, может быть вредным. Поскольку биотин участвует в формировании кожи и волос, некоторые производители разработали добавки, содержащие огромное количество биотина.Эти составы, которые утверждают, что способствуют здоровью волос, ногтей и кожи, содержат в сотни раз рекомендуемую дневную дозу биотина.

Сам по себе биотин не токсичен. Проблема в том, что очень высокий уровень биотина может повлиять на результаты анализов крови, включая уровни гормонов щитовидной железы и тесты сердечного приступа. В 2019 году FDA вновь подчеркнуло свое предупреждение 2017 года о ложно завышенных или заниженных результатах различных анализов крови у людей, принимающих биотин (FDA, 2019). Это может быть очень опасно.Например, если у человека, принимающего высокие дозы биотина, случится сердечный приступ, биотин может исказить результаты его анализов крови и помешать поставщику медицинских услуг распознать его.

Витамин С сам по себе не помогает в лечении выпадения волос. Нет никаких доказательств того, что ваш уровень витамина C связан с ростом ваших волос (Almohanna, 2019). Однако это может быть полезно, если у вас дефицит железа, потому что витамин С помогает вашему организму усваивать больше железа.

Витамин D — единственный витамин, который, как показывают научные данные, может быть полезным при выпадении волос.Исследователи отмечают, что при низком уровне витамина D прием добавок витамина D может улучшить симптомы облысения, особенно если причиной является гнездная алопеция, аутоиммунное заболевание или телогеновый отток (TE), временное выпадение волос, вызванное стрессом или травмой ( Альмоханна, 2019).

Лечение выпадения волос, причины и диагностика

В одном исследовании ученые изучали уровень витамина D у 45 мужчин с очаговой алопецией и у 45 контрольных субъектов.Они обнаружили, что у людей с выпадением волос уровень витамина D значительно ниже. Самые низкие уровни коррелировали с более серьезным выпадением волос (Gade, 2018).

В другом исследовании изучался уровень витамина D у 30 мужчин с очаговой алопецией и 30 человек контрольной группы. Было обнаружено, что 96,7% мужчин с очаговой алопецией имели дефицит витамина D по сравнению с только 73% мужчин без выпадения волос (Daroach, 2017).

Ваше тело естественным образом вырабатывает витамин D, когда ваша кожа подвергается воздействию солнца.Вы также получаете его из таких продуктов, как молоко и яйца. Но многие американцы испытывают дефицит витамина D, особенно зимой. Если у вас истончение волос, возможно, вам стоит проверить уровень у врача и обсудить с ним, следует ли вам принимать добавки с витамином D.

Прием витамина D — не панацея для роста волос. Тем не менее, есть и другие преимущества для обеспечения адекватного уровня.

Витамин Е — мощный антиоксидант, который уничтожает вредные свободные радикалы в вашем теле, поэтому он дает важный импульс иммунной системе.Но мнение о его влиянии на облысение отсутствует. Одно исследование показало, что у людей с облысением по мужскому типу уровень витамина Е ниже, чем у людей без него, в то время как другое исследование не обнаружило разницы между этими двумя группами — далеко не достаточно доказательств, чтобы рекомендовать принимать его в качестве добавки для волос (Рамадан, 2013; Назироглу, 2000). .

Некоторые исследования показали, что прием добавок железа эффективен против выпадения волос у людей с дефицитом железа (Rushton, 2002). Низкое содержание железа чаще встречается у женщин, потому что железо теряется во время менструации.Выпадение волос у мужчин редко происходит из-за низкого содержания железа, а дефицит железа может быть связан с другими состояниями. Если вы подозреваете, что у вас дефицит железа, пройдите тест на его уровень и следуйте рекомендациям врача.

Если у вас нет дефицита селена, нет никаких доказательств того, что селен эффективен против облысения по мужскому типу. Фактически, как и витамин А, прием большого количества селена был связан с выпадением волос (MacFarquhar, 2010).

Лекарства, вызывающие выпадение волос: что нужно знать

На протяжении десятилетий исследования цинка и выпадения волос проводились повсюду.Некоторые исследования показывают связь между низким уровнем цинка и выпадением волос; другие исследования — нет. Некоторые исследования показывают корреляцию между точным уровнем цинка и тяжестью выпадения волос; другие исследования противоречат этому. Дефицит цинка может быть связан с выпадением волос, но нет данных в пользу приема добавок цинка для здоровья волос при отсутствии дефицита железа (Almohanna, 2019).

Многие диетологи говорят, что никакая добавка не может сравниться с преимуществами получения необходимых питательных веществ из продуктов питания и природных источников.Когда дело доходит до выпадения волос, научные данные свидетельствуют о том, что добавление питательных веществ, в которых вы не испытываете дефицита, в лучшем случае может быть пустой тратой времени, а в худшем — быть вредным. Когда дело доходит до облысения по мужскому типу, нет ничего эффективнее таких препаратов, как финастерид (торговая марка Propecia; см. Важную информацию по безопасности) и миноксидил (торговая марка Rogaine).

  1. Альмоханна, Х. М., Ахмед, А. А., Цаталис, Дж. П., и Тости, А. (2019). Роль витаминов и минералов в выпадении волос: обзор. Дерматология и терапия , 9 (1), 51–70. DOI: 10.1007 / s13555-018-0278-6. Получено с https://pubmed.ncbi.nlm.nih.gov/30547302/
  2. .
  3. Дароач, М., Наранг, Т., Сайкия, У. Н., Сачдева, Н., и Сендхил Кумаран, М. (2017). Корреляция экспрессии витамина D и рецептора витамина D у пациентов с очаговой алопецией: клиническая парадигма. Международный журнал дерматологии , 57 (2), 217–222. DOI: 10.1111 / ijd.13851. Получено с https: // pubmed.ncbi.nlm.nih.gov/2

    39/
  4. Гаде, В. К. В., Мони, А., Мунисами, М., Чандрашекар, Л., и Раджаппа, М. (2018). Исследование статуса витамина D при очаговой алопеции. Клиническая и экспериментальная медицина , 18 (4), 577–584. DOI: 10.1007 / s10238-018-0511-8. Получено с https://pubmed.ncbi.nlm.nih.gov/29869122/
  5. .
  6. MacFarquhar, J. K., Broussard, D. L., Melstrom, P., Hutchinson, R., Wolkin, A., Martin, C., et al. (2010). Острая токсичность селена, связанная с диетической добавкой. Архив внутренней медицины , 170 (3), 256–261. DOI: 10.1001 / archinternmed.2009.495. Получено с https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3225252/
  7. .
  8. Назироглу, М., и Коккам, И. (2000). Статус антиоксидантов и перекисного окисления липидов в крови пациентов с алопецией. Биохимия и функции клетки , 18 (3), 169–173. DOI: 10.1002 / 1099-0844 (200009) 18: 3 <169 :: aid-cbf870> 3.0.co; 2-т. Получено с https://pubmed.ncbi.nlm.nih.gov/10965354/
  9. Рамадан Р., Тауди А., Хэй Р. А., Рашед Л. и Тауфик Д. (2013). Антиоксидантная роль параоксоназы 1 и витамина E в трех аутоиммунных заболеваниях. Фармакология и физиология кожи , 26 , 2–7. DOI: 10,1159 / 000342124. Получено с https://pubmed.ncbi.nlm.nih.gov/22986950/
  10. .
  11. Раштон Д. Х. (2002). Факторы питания и выпадение волос. Клиническая и экспериментальная дерматология, 27 (5), 396–404. DOI: 10,1046 / j.1365-2230.2002.01076.x. Получено с https://pubmed.ncbi.nlm.nih.gov/121/
  12. .
  13. Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США. (2019, 5 ноября). FDA предупреждает, что биотин может помешать лабораторным тестам. Получено с https://www.fda.gov/medical-devices/safety-communications/update-fda-warns-biotin-may-interfere-lab-tests-fda-safety-communication
  14. .

Подробнее

Пять питательных веществ, необходимых для роста волос

Незаменимые витамины и минералы для крепких и блестящих локонов

Выпадение волос и старение — частые побочные эффекты старения.Внешние процедуры для волос, такие как кондиционирование и смазывание маслом, могут помочь сохранить здоровье волос, но они не могут сделать многое. Омоложение волос и лечение выпадения волос Provita — это комплексное лечение, которое воздействует на все части волос — от кожи головы до кончиков — и использует белки, витамины и факторы роста с помощью мезотерапии и светодиодной терапии, чтобы помочь обратить вспять повреждение и выпадение волос. . Хотя методы лечения превосходны для долгосрочных и впечатляющих результатов, если они не сопровождаются здоровым образом жизни, эффекты не будут столь же эффективными.Сосредоточение внимания на том, что мы едим, чтобы гарантировать получение рекомендуемой суточной дозы витаминов и минералов, стимулирующих рост волос, является ключом к здоровым волосам. Вот пять самых важных питательных веществ для роста волос.

Витамин A

Витамин А способствует образованию кожного сала и кожного сала. Этот витамин важен для поддержания влажности, которая сохранит ваши пряди блестящими и объемными. Он также обеспечивает крепкие фолликулы и правильное кровообращение, что предотвращает выпадение волос и способствует их росту.Зеленые овощи, такие как шпинат, брокколи и капуста, являются богатыми источниками витамина А. Морковь, жир печени трески, персики, абрикосы, горох и тыква также являются хорошими источниками этого питательного вещества. Рекомендуемая суточная доза витамина А составляет 900 мкг для мужчин и 700 мкг для женщин.

Витамин C

Витамин С способствует выработке коллагена, а аминокислоты, содержащиеся в коллагене, помогают вырабатывать кератин — белок, отвечающий за здоровье волос. Это увеличивает эластичность кожи головы, а также укрепляет фолликулы, что помогает предотвратить выпадение волос.Также известно, что коллаген помогает бороться с поседением волос. Витамин С обладает антиоксидантными свойствами, которые замедляют процесс старения волос, препятствуя накоплению свободных радикалов. Лимоны, апельсины, помидоры и другие цитрусовые содержат большое количество витамина С. Овощи, такие как брокколи, капуста и капуста, также являются хорошими источниками витамина С. Витамин С легко доступен в форме добавок и является одним из важнейших питательных веществ для здоровья человека. рост волос. Принимайте суточную дозу 75-90 мг.

Биотин

Биотин — это питательный микроэлемент, необходимый для превращения пищи в энергию.Исследования показывают, что биотин эффективен при лечении выпадения волос, увеличивает объем и блеск волос. Биотин способствует выработке и поддержанию кератина и является одним из важнейших питательных веществ для роста волос. Такие продукты, как яйца, орехи, бананы и авокадо, помогают замедлить процесс старения волос. Рекомендуемая суточная доза биотина составляет 30-100 мкг для лиц старше 10 лет.

цинк

Этот пищевой минерал способствует функционированию клеток, а также росту и восстановлению тканей.Цинк также важен для правильного функционирования сальных желез, окружающих волосяные фолликулы. Хотя недостаточно доказательств того, что цинк может обратить вспять выпадение волос, известно, что дефицит цинка вызывает выпадение и истончение волос. Цинк действительно восстанавливает некоторую степень повреждения волос, но минерал в основном важен для поддержания объема волос. Мясо, орехи, чечевица, яйца и цельнозерновые продукты являются подходящими источниками для получения цинка. Дефицит цинка часто встречается у вегетарианцев и веганов, но прием цинковых добавок не менее полезен.Рекомендуемая дневная доза цинка составляет 8-11 мг.

Утюг

Железо является вторым по важности питательным веществом для роста волос после белка. Он помогает доставлять кислород к корням волос и улучшает кровообращение. Дефицит железа может вызвать облысение как у мужчин, так и у женщин. Низкий уровень железа также может привести к преждевременному поседению. Зеленые листовые овощи, бобовые, рыба и мясо содержат железо, которое помогает поддерживать качество волос. Рекомендуемая суточная дозировка железа составляет 15 мг.

Белки, фолиевая кислота, омега-3 жирные кислоты, витамин Е и антиоксиданты также являются важными питательными веществами для роста волос. Здоровые волосы — это признак красоты и молодости, а сбалансированная диета, полная витаминов и минералов, дополненная соответствующими процедурами для волос в клинике, — идеальное сочетание для красивых волос.

Чтобы узнать больше о лечении волос, закажите у нас консультацию здесь.

ИЗОБРАЖЕНИЕ ПРЕДОСТАВЛЕНО:

аналогов витамина D3 стимулируют рост волос у голых мышей | Эндокринология

Аннотация

Активная форма витамина D 3 может регулировать кератинизацию эпидермиса, индуцируя терминальную дифференцировку; а у мышей, лишенных рецептора витамина D, обнаруживаются дефекты, приводящие к послеродовой алопеции. Эти наблюдения указывают на то, что витамин D 3 участвует в регуляции роста волос. Мы проверили способность 1,25 дигидроксивитамина D 3 и его синтетических аналогов стимулировать рост волос у мышей biege / nude / xid (BNX) nu / nu (nude) с врожденной алопецией.Голых мышей лечили различными аналогами витамина D 3 в дозах, которые, как мы ранее обнаружили, являются наивысшими дозами, не вызывающими токсичности (гиперкальциемии). За мышами наблюдали рост волос и оценивали их по определенной шкале. Образцы кожи были взяты для гистологического исследования волосяных фолликулов и для экстракции РНК и белка. Аналоги витамина D 3 резко стимулировали рост волос у голых мышей, хотя исходный 1,25 дигидроксивитамин D 3 не имел никакого эффекта.Рост волос происходил по циклической схеме, сопровождавшейся образованием нормальных волосяных фолликулов и повышенной экспрессией определенных кератинов (Ha7, Ha8 и Hb3). Аналоги витамина D 3 , по-видимому, действуют на кератиноциты, инициируя круговорот волосяных фолликулов и стимулируя рост волос у мышей, у которых в противном случае волосы не растут.

В ходе наших исследований противоопухолевых свойств аналогов витамина D 3 мы обычно использовали мышей с тройным иммунодефицитом beige / nude / xid (BNX) nu / nu (nude) для проверки способности этих соединений предотвращать рост опухоли in vivo .Мы заметили, что у голых мышей росли волосы, когда они получали некоторые аналоги витамина D 3 .

У голых мышей есть изменение зародышевой линии гена Whn (недавно названного Foxn1), влияющее как на рост фолликулярных волос, так и на развитие тимуса (1, 2). У этих мышей ген Whn имеет делецию одного нуклеотида, вызывающую мутацию со сдвигом рамки считывания с преждевременным завершением, что приводит к нефункциональному белку. Ген Whn, фактор транскрипции вилки, экспрессируется исключительно в эпителиальных клетках у всех видов позвоночных.Гены Whn человека и мыши имеют 85% идентичности последовательностей (2). Люди с фенотипом обнаженного тела также имеют врожденную алопецию в результате бессмысленной мутации этого гена (3). Необходимо определить транскрипционные мишени Whn, но они включают гены кератина в волосяном фолликуле. Whn необходим для созревания и дифференцировки матричных эпителиальных клеток. Обычно он экспрессируется в луковице фолликула и наружной корневой оболочке стержня волоса во время образования волос; Отсутствие этого генного продукта у мышей nude приводит к неправильному ороговению фолликулярных эпителиальных клеток, что приводит к дефектам корневого влагалища, кутикулы и коры головного мозга, что приводит к ослаблению волос (2, 4, 5).Волосы расслаиваются в фолликуле, образуя кожные кисты (4), содержащие ороговевший материал.

Активная форма витамина D 3 является лигандом для рецептора ядерного гормона, рецептора витамина D 3 (VDR). Мыши с нокаутом VDR не могут инициировать новый цикл роста волос, проявляя послеродовую алопецию (6). Экспрессия VDR в дермальных сосочках в фолликулярных кератиноцитах во время стадий анагена (рост) и катагена (прекращение) цикла волос предполагает роль VDR в прогрессировании цикла волос (7).Кроме того, обработка кератиноцитов тремя аналогами витамина D 3 ингибировала пролиферацию и стимулировала дифференцировку (8).

Эти наблюдения побудили нас изучить способность аналогов витамина D 3 стимулировать рост волос у голых мышей с дефектами кератиноцитов. Было разработано большое количество аналогов витамина D 3 , которые обладают большей способностью вызывать дифференцировку и ингибировать пролиферацию, но вызывают меньшую гиперкальциемию, чем физиологически активное соединение 1,25 дигидроксивитамин D 3 [1,25 (OH ) 2 D 3 ] (9).Мы выбрали шесть аналогов витамина D 3 , которые соответствовали этим характеристикам, и исследовали их способность вызывать рост волос у голых мышей (10–15).

Материалы и методы

Мыши

В наших исследованиях использовали

BNX nu / nu самцов и самок мышей в возрасте 8 недель. Животные содержались в помещении для животных Медицинского центра Сидарс-Синай, и эксперименты проводились в соответствии с установленными правилами.В одной серии экспериментов по три мужчины были распределены в каждую из шести групп, и каждая когорта получала различное соединение витамина D 3 , а седьмая группа состояла из необработанного контроля BNX nu / nu . Кроме того, трем самцам и трем самкам мышей вводили аналог витамина D 3 , EB1089. Все аналоги вводили внутрибрюшинно три раза в неделю в объеме 200 мкл PBS. Для экспериментов по выщипыванию волос выщипывали волосы из нижней части спины мышей C57 BL / 6 и вводили аналоги витамина D 3 , как описано выше.

Витамин D

3 соединений

Соединения витамина D 3 (рис. 1) растворяли в абсолютном этаноле перед определением молярной концентрации, измеренной с помощью УФ-поглощения с использованием их молярного коэффициента экстинкции при 264 нм. Все аналоги хранили в темноте и при -80 ° C в абсолютном этаноле в виде исходных растворов 10 -3 моль. Последнее разведение было сделано в PBS перед введением мышам. Мышам вводили дозы соединений витамина D 3 , которые, как мы ранее обнаружили, не вызывают токсичности, включая гиперкальциемию.Кроме того, во время лечения мы контролировали уровень кальция в сыворотке крови.

Рисунок 1.

Физическая структура витамина D 3 соединений, использованных в этом исследовании.

Рисунок 1.

Физическая структура витамина D 3 соединений, использованных в этом исследовании.

1,25- (ОН)
2 D 3

1α, 25-дигидроксихолекальциферол, физиологически активная форма витамина D 3 , вводили при 0.0625 мкг / мышь; это было сделано Hoffman-LaRoche Inc.

Ro 25-9022

1α, 25- (OH) 2 -16-ен-23-ин-26,27-F6–19-нор-витамин D 3 имеет шесть фторов в боковой цепи, ненасыщенность по C16 и C23, и удаление метиленовой группы C-19. Его вводили в дозе 0,00125 мкг / мышь. Аналог произведен компанией Hoffman-LaRoche Inc.

KH 1060
.

1α, 25- (OH) 2 -20-эпи-22-окса-24,26,27-тришомовитамин D 3 имеет удлинение боковой цепи и замену углерода C 22 на кислород.Он был произведен Leo Pharmaceuticals и вводился в дозе 0,0125 мкг / мышь.

EB1089

1α, 25- (OH) 2 -диен-24,26,27-тригомовитамин D 3 имеет измененную боковую цепь с 26,27 диметильными группами со вставкой дополнительного углерода в C- 24 (24a) и две двойные связи trans при атомах углерода 22,23 и 24,24a. Он был произведен Leo Pharmaceuticals и давался в дозе 0,05 мкг / мышь.

Ro 27-0574

1α, 25 (OH) 2 -23-ен-26,27-гексафтор-19-нор-20-циклопил витамин D 3 содержит шесть фторов в боковой цепи, транс-23,24 двойной связь и циклопропильная группа при C 20 .Он был произведен Hoffman-LaRoche Inc. и давался в дозе 0,005 мкг / мышь.

Ro 27-5646

1α, 25 (OH) 2 — (3-метил-3-гидроксибутил) -19-нор-витамин D 3 имеет две боковые цепи с удалением метиленовой группы C-19 и был задан 0,01 мкг / мышь. Это было сделано Hoffman-LaRoche Inc.

Ro 26-9114

1α, 25 (OH) 2 -16-ен-19-нор-24-оксо-витамин D 3 содержит двойную связь у C-16 и кетогруппу в боковой цепи.Он был синтезирован Hoffman-LaRoche Inc. и вводился в дозе 6 мкг / мышь.

Весы для мониторинга волос у мышей BNX nu / nu

Мы разработали шкалу для измерения роста волос у мышей BNX (таблица 1).

Таблица 1. Шкала

для мониторинга волос у мышей BNX nu / nu

4 9036 Кожа толстая, пигментированные, рассеянные волосы
SCORE . ОПИСАНИЕ .
1 Кожа розовая, без волос
2 Кожа толстая, пигментированная, без волос
3 Кожа толстая, сильно пигментированная, без волос
5 Волосы 1–10% тела
6 Волосы 10–25% тела
7 Волосы 25–50% тела
8 Волосы 50–75% тела
9 Волосы> 75% тела
10 Волосы 100% тела
. 4 9036 Кожа толстая, пигментированные, рассеянные волосы
ОПИСАНИЕ .
1 Кожа розовая, без волос
2 Кожа толстая, пигментированная, без волос
3 Кожа толстая, сильно пигментированная, без волос
5 Волосы 1–10% тела
6 Волосы 10–25% тела
7 Волосы 25–50% тела
8 Волосы 50–75% тела
9 Волосы> 75% тела
10 Волосы 100% тела
Таблица 1.

Весы для мониторинга волос у мышей BNX nu / nu

4 9036 Кожа толстая, пигментированные, рассеянные волосы
SCORE . ОПИСАНИЕ .
1 Кожа розовая, без волос
2 Кожа толстая, пигментированная, без волос
3 Кожа толстая, сильно пигментированная, без волос
5 Волосы 1–10% тела
6 Волосы 10–25% тела
7 Волосы 25–50% тела
8 Волосы 50–75% тела
9 Волосы> 75% тела
10 Волосы 100% тела
. 4 9036 Кожа толстая, пигментированные, рассеянные волосы
ОПИСАНИЕ .
1 Кожа розовая, без волос
2 Кожа толстая, пигментированная, без волос
3 Кожа толстая, сильно пигментированная, без волос
5 Волосы 1–10% тела
6 Волосы 10–25% тела
7 Волосы 25–50% тела
8 Волосы 50–75% тела
9 Волосы> 75% тела
10 Волосы 100% тела

Гистологический анализ волосяных фолликулов

Образцы кожи были получены после обработки либо соединениями витамина D 3 , либо контрольным разбавителем.Их фиксировали для гистологического анализа в 10% нейтральном забуференном формалине, окрашивали гематоксилином / эозином и исследовали под микроскопом.

Анализ РНК

Образцы кожи мышей с максимальной оценкой были обработаны на РНК, преобразованы в кДНК и использованы в ПЦР для проверки экспрессии генов различных кератинов (10). Праймеры для генов кератина показаны в таблице 2.

Таблица 2.

Праймеры для генов кератина

Кератиновый тип волос . Праймер передний . Обратный праймер .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG
Кератиновый тип волос . Праймер передний . Обратный праймер .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG
Таблица 2.

Праймеры для генов кератина

Волосы кератинового типа . Праймер передний . Обратный праймер .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG
Кератиновый тип волос . Праймер передний . Обратный праймер .
кератина A1 AGCTGTGACCTGGCTCTGGTTC CCACTGGCACATCAGAGAGTTC
кератина A4 TCTGGAGCTCAGCTGACATC ACCTTAAGTAGTAACTGGAGCTC
кератина A7 CCCTAAATCAACCGGTAGCAG TTTAATGCAGGGAACCCAGTTAC
кератина A8 CTGGCTAAGGCGGGAGATAC GTAGCTGACATCCAGCCAC
Кератин B3 AGCAGAGGCTGTGTGAAGGTG GGAAAAGCCAGCGATGTGCTG

Анализ белков

Антисыворотки против кератиновых белков использовали для вестерн-блоттинга для установления паттернов экспрессии на уровне белка (16, 17).Одна антисыворотка была против кислого кератина волоса типа I Ha8, который обычно проявляет сложный характер экспрессии в растущих фолликулах; и вторым признанным основным кератином волос типа II Hb3.

Результаты

Голые мыши получали либо соединения витамина D 3 , либо контрольный разбавитель в дозе, которая, как мы ранее обнаружили, ингибировала клональную пролиферацию раковых клеток, но не была связана с гиперкальциемией, которая является основной токсичностью витамина D 3 (Таблица 3 , Инжир.1, и ссылки. 10–13). У этих мышей развились волосы, как показано на фиг. 2. Гистологическое исследование подтвердило, что аналоги витамина D 3 стимулировали образование волосяных фолликулов (фиг. 3). Наблюдение под микроскопом образцов кожи с пиком 8 в группах лечения аналогом витамина D 3 показало полностью сформированный волосяной фолликул; Напротив, в контрольных образцах не наблюдали волосяного фолликула или только деформированные волосяные фолликулы.

Рисунок 2.

Фотография голых мышей.A. Верхняя мышь получала контроль с разбавителем, а мышь нижняя получала аналог витамина D 3 , Ro 25-9022 в дозе 0,00125 мкг / мышь внутрибрюшинно три раза в неделю. B. Мыши получали слева направо : Ro 27-5646 в концентрации 0,01 мкг / мышь, контроль с разбавителем, и Ro27-0574 в концентрации 0,005 мкг / мышь.

Рисунок 2.

Фотография голых мышей. A. Верхняя мышь получала контроль разбавителя, а мышь нижняя получала аналог витамина D 3 , Ro 25-9022, при 0.00125 мкг / мышь внутрибрюшинно, три раза в неделю. B. Мыши получали слева направо : Ro 27-5646 в концентрации 0,01 мкг / мышь, контроль с разбавителем, и Ro27-0574 в концентрации 0,005 мкг / мышь.

Рис. 3.

A, Кожа контрольной голой мыши с абортивными волосяными фолликулами и рудиментарными волосянистыми единицами. Подопытная голая мышь (B) обнаружила нормальные волосяные фолликулы, простирающиеся в подкожную ткань. Эта мышь получала Ro 25-9022 в дозе 0,00125 мкг / мышь внутрибрюшинно три раза в неделю в течение 36 дней (см.2). Срезы окрашивали гематоксилином и эозином (исходное увеличение × 100).

Рис. 3.

A, Кожа контрольной «голой мыши» с абортивными волосяными фолликулами и рудиментарными волосяными клетками. Подопытная голая мышь (B) обнаружила нормальные волосяные фолликулы, простирающиеся в подкожную ткань. Эта мышь получала Ro 25-9022 в дозе 0,00125 мкг / мышь внутрибрюшинно три раза в неделю в течение 36 дней (см. Фиг. 2). Срезы окрашивали гематоксилином и эозином (исходное увеличение × 100).

Таблица 3.

Витамин D 3 соединений: сводка их антипролиферативной и кальциемической активности

EB 1,2354
Соединения . ED 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . МСФ-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0.01 мкг / мышь 10
Ro 27-0574 2 × 10 −10 2 × 10 −9 ND 10 14
5 × 10 −11 0,5 мкг / кг 12
Ro 26-9114 1 × 10 −10 6 мкг3 11
Ro 25-9022 2 × 10 −10 6 × 10 −10 0.00125 мкг / мышь 15
KH 1060 1 × 10 −12 1 × 10 −10 0,0125 мкг / мышь 13
2 D 3 1 × 10 −8 1 × 10 −7 0,0625 мкг / мышь 10, 11, 12, 13, 14, 15
−10 -2 × 10 10
Соединения . ED 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . МСФ-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0,01 мкг / мышь 10
Ro 27-0574 2 2 × 10 −9 ND a 14
EB 1089 5 × 10 −11 0.5 мкг / кг 12
Ro 26-9114 1 × 10 −10 6 мкг / мышь 11
Ro 25-9022 6 × 10 −10 0,00125 мкг / мышь 15
KH 1060 1 × 10 −12 1 × 10 −10 0,0364 9036 г / мышь 13
1,25 (OH) 2 D 3 1 × 10 −8 1 × 10 −7 0.0625 мкг / мышь 10, 11, 12, 13, 14, 15
Таблица 3.

Витамин D 3 соединений: сводка их антипролиферативной и кальциемической активности

EB 1,2354
Соединения . ED 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . МСФ-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0.01 мкг / мышь 10
Ro 27-0574 2 × 10 −10 2 × 10 −9 ND 10 14
5 × 10 −11 0,5 мкг / кг 12
Ro 26-9114 1 × 10 −10 6 мкг3 11
Ro 25-9022 2 × 10 −10 6 × 10 −10 0.00125 мкг / мышь 15
KH 1060 1 × 10 −12 1 × 10 −10 0,0125 мкг / мышь 13
2 D 3 1 × 10 −8 1 × 10 −7 0,0625 мкг / мышь 10, 11, 12, 13, 14, 15
−10 -2 × 10 10
Соединения . ED 50 (м) . Максимальная негиперкальциемическая доза . Арт. .
HL60 . МСФ-7 .
Ro 27-5646 2 × 10 −10 4 × 10 −10 0,01 мкг / мышь 10
Ro 27-0574 2 2 × 10 −9 ND a 14
EB 1089 5 × 10 −11 0.5 мкг / кг 12
Ro 26-9114 1 × 10 −10 6 мкг / мышь 11
Ro 25-9022 6 × 10 −10 0,00125 мкг / мышь 15
KH 1060 1 × 10 −12 1 × 10 −10 0,0364 9036 г / мышь 13
1,25 (OH) 2 D 3 1 × 10 −8 1 × 10 −7 0.0625 мкг / мышь 10, 11, 12, 13, 14, 15

Мы исследовали рост волос голых мышей, когда они получали разбавитель (контрольные мыши), 1,25 (OH) 2 D 3 , или один из пяти аналогов витамина D 3 . Каждая группа состояла из трех мышей. Влияние аналогов витамина D 3 на рост волос голых мышей систематически оценивали для каждой мыши, выставляя им баллы по шкале от 1 до 10 (таблица 1), три раза в неделю. Оценка роста волос учитывает толщину и пигментацию кожи, поскольку это косвенно коррелирует с индукцией анагена, который является фазой роста волосяного цикла.Например, оценка 5 означает утолщение кожи с сильной пигментацией, что отражает формирование стержня волоса до выступа волос над поверхностью кожи. Время до появления волос и количество волос варьировали от мыши к мыши и для аналогов витамина D 3 (фиг. 4).

Рисунок 4.

Влияние соединений витамина D 3 на рост волос у мышей nude. Мышей лечили соединениями витамина D 3 внутрибрюшинно три раза в неделю и оценивали рост волос в соответствии с определениями, приведенными в таблице 1.Каждая панель показывает репрезентативные эксперименты. Все мыши были самцами, за исключением самок, показанных на F. *, P <0,05; #, P <0,05 для самок мышей, представленных в F.

Рисунок 4.

Влияние соединений витамина D 3 на рост волос у голых мышей. Мышей лечили соединениями витамина D 3 внутрибрюшинно три раза в неделю и оценивали рост волос в соответствии с определениями, приведенными в таблице 1. На каждой панели показаны репрезентативные эксперименты.Все мыши были самцами, за исключением самок, показанных на F. *, P <0,05; #, P <0,05 для самок мышей, представленных в F.

Максимальный показатель роста волос был постоянно выше у мышей, получавших аналоги витамина D 3 , чем у контрольных мышей (таблица 4). Соединения KH 1060, Ro 27-5646 и EB1089 были наиболее эффективными при стимуляции роста волос. 1,25 (OH) 2 D 3 мало влияли на рост волос (таблица 4, рис.4). Время для достижения максимального роста волос варьировалось в группах лечения витамином D 3 . Например, латентный период составлял в среднем 9 дней для мышей, получавших группы Ro 27-0574 или EB1089 (самки), тогда как он составлял 18 дней для самцов, получавших EB1089, и 21 день для мышей, получавших KH 1060 (рис. ). Быстрая потеря волос довела показатели до исходного уровня в течение 4 дней, даже несмотря на то, что лечение аналогом витамина D 3 не было прекращено. Второй цикл роста волос (пиковая оценка 7–8) произошел в группах лечения Ro 25-9022, Ro 27-0574 и EB1089 примерно через 19 дней после первого цикла.Мы также исследовали способность EB1089 стимулировать рост волос у самцов и самок мышей. У обоих была стимуляция волос; первый пик роста волос у женщин немного предшествовал пику у мужчин (рис. 4F).

Таблица 4.

Сводная информация о наивысших показателях волосяного покрова, полученных у голых мышей, получавших витамин D 3 аналогов

Среднее значение00 3
. Контроль . 1,25 (ОН) 2 D 3 . Ro 25-9022 . KH 1060 . Ro 27-0574 . Ro 27-5646 . EB1089 .
Мужской . Женский .
Наивысший результат 5 5 8 8 8 8 7 7
9036 436 4 5 7 8 7
3 4 8 6 8 6 4 7
4,67 7,67 6,67 7,00 7,00 6,33 7,00
sd 1,00 0,58 903 0,00
P значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01
Среднее значение00 3
. Контроль . 1,25 (ОН) 2 D 3 . Ro 25-9022 . KH 1060 . Ro 27-0574 . Ro 27-5646 . EB1089 .
Мужской . Женский .
Наивысший результат 5 5 8 8 8 8 7 7
9036 436 4 5 7 8 7
3 4 8 6 8 6 4 7
4,67 7,67 6,67 7,00 7,00 6,33 7,00
sd 1,00 0,58 903 0,00
P значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01
Таблица 4.

Сводные данные о наивысших показателях волосяного покрова, достигнутых голыми мышами, получавшими витамин D 3 аналогов

Среднее значение00 3
. Контроль . 1,25 (ОН) 2 D 3 . Ro 25-9022 . KH 1060 . Ro 27-0574 . Ro 27-5646 . EB1089 .
Мужской . Женский .
Наивысший результат 5 5 8 8 8 8 7 7
9036 436 4 5 7 8 7
3 4 8 6 8 6 4 7
4,67 7,67 6,67 7,00 7,00 6,33 7,00
sd 1,00 0,58 903 0,00
P значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01
Среднее значение00 3
. Контроль . 1,25 (ОН) 2 D 3 . Ro 25-9022 . KH 1060 . Ro 27-0574 . Ro 27-5646 . EB1089 .
Мужской . Женский .
Наивысший результат 5 5 8 8 8 8 7 7
9036 436 4 5 7 8 7
3 4 8 6 8 6 4 7
4,67 7,67 6,67 7,00 7,00 6,33 7,00
sd 1,00 0,58 903 0,00
P значение 0,37 0,01 0,04 0,06 0,02 0,16 0.01

РНК и белок были экстрагированы из одних и тех же образцов кожи с наивысшим баллом около 8 у мышей, получавших EB1089 и Ro 25-9022, и у мышей, получавших 1,25 (OH) 2 D 3 или контроль разбавителя. КДНК была сделана и амплифицирована для экспрессии кератиновых генов. Экспрессия мРНК кератина дифференциально регулировалась в коже животных, получавших аналог витамина D 3 (фиг. 5). 1,25 (OH) 2 D 3 увеличивал экспрессию мРНК Ha1, но не влиял на уровни каких-либо других исследованных кератинов (рис.5, А и Б). Кожа мышей, получавших EB1089 или Ro 25-9022, показала значительно повышенную экспрессию мРНК ( P <0,05) кератинов Ha1, Ha7, Ha8 и Hb3. Экспрессия На4 значимо не увеличивалась ни при каком лечении. Экспрессию кератинов Hb3 и Ha8 определяли на уровне белка с помощью вестерн-блоттинга (рис. 6). В соответствии с результатами ПЦР уровни Hb3 и Ha8 были увеличены в коже мышей, обработанных Ro 25-9022 и EB 1089, но не обработанных 1,25 (OH) 2 D 3 .

Рисунок 5.

A, Влияние витамина D 3 аналогов на экспрессию мРНК кератина в коже голых мышей. A, RT-PCR анализ РНК, полученной из кожи мышей, обработанных либо контрольным разбавителем, 1,25 (OH) 2 D 3 , либо аналогами витамина D 3 . КДНК с обратной транскрипцией амплифицировали с помощью ПЦР с использованием наборов праймеров, специфичных для кератинов, для 35 циклов или 18S РНК для 25 циклов. В. Цифровое количественное определение сигналов для пяти кератинов, как показано на А.Относительная экспрессия кератина определяется путем нормализации до уровней 18S РНК. Результаты представлены в виде процента экспрессии по сравнению с контрольными мышами. *, P <0,05.

Рисунок 5.

A, Влияние витамина D 3 аналогов на экспрессию мРНК кератина в коже голых мышей. A, RT-PCR анализ РНК, полученной из кожи мышей, обработанных либо контрольным разбавителем, 1,25 (OH) 2 D 3 , либо аналогами витамина D 3 .КДНК с обратной транскрипцией амплифицировали с помощью ПЦР с использованием наборов праймеров, специфичных для кератинов, для 35 циклов или 18S РНК для 25 циклов. B. Цифровое количественное определение сигналов для пяти кератинов, как показано на рисунке A. Относительная экспрессия кератина определяется путем нормализации до уровней 18S РНК. Результаты представлены в виде процента экспрессии по сравнению с контрольными мышами. *, P <0,05.

Рисунок 6.

Влияние аналогов витамина D 3 на экспрессию белков кератина волос.Вестерн-блоттинг зондировали последовательно антисыворотками против Hb3 и Ha8, а также глицеральдегид-3-фосфатдегидрогеназой (контроль нагрузки).

Рисунок 6.

Влияние аналогов витамина D 3 на экспрессию белков кератина волос. Вестерн-блоттинг зондировали последовательно антисыворотками против Hb3 и Ha8, а также глицеральдегид-3-фосфатдегидрогеназой (контроль нагрузки).

Чтобы выяснить, является ли эффект стимуляции роста волос аналогами витамина D 3 специфическим для голых мышей, мышам C57 BL / 6 давали Ro 25-9022 или Ro 26-9114 три раза в неделю после возобновления роста волос. стимулировался выщипыванием волос.Оценка волос производилась три раза в неделю с использованием той же шкалы, которая описана в таблице 1. Во время лечения любым из аналогов витамина D 3 не наблюдалось ускорения роста волос (фиг. 7).

Рисунок 7.

Влияние аналогов витамина D 3 на индукцию образования новых волос после выщипывания волос у мышей C57 BL / 6. Мыши C57 BL / 6 получали контрольный разбавитель Ro 26-9114 или Ro 25-9022 три раза в неделю со дня выщипывания волос.Оценка волос производилась три раза в неделю. Каждый символ представляет собой среднее значение ± стандартное отклонение от восьми мышей.

Рис. 7.

Влияние аналогов витамина D 3 на индукцию образования новых волос после выщипывания волос у мышей C57 BL / 6. Мыши C57 BL / 6 получали контрольный разбавитель Ro 26-9114 или Ro 25-9022 три раза в неделю со дня выщипывания волос. Оценка волос производилась три раза в неделю. Каждый символ представляет собой среднее значение ± стандартное отклонение от восьми мышей.

Обсуждение

Волосяные фолликулы непрерывно проходят три фазы (см.18): фаза роста (анаген), стадия инволюции (катаген) и период покоя (телоген). Молекулярные сигналы, которые контролируют переход фолликулов между этими стадиями, до конца не изучены. На рост волос влияют различные гормоны, в том числе эстроген, гормон роста и андрогены (19, 20). Андрогены могут способствовать миниатюризации фолликулов и сокращению продолжительности стадии анагена. Напротив, эстроген может продлить стадию анагена.

Стимуляция роста волос — это так называемый Святой Грааль, к которому стремятся многие ученые, особенно в фармацевтических компаниях.На рынке представлено несколько препаратов, стимулирующих рост волос, в том числе миноксидил и финастерид (21, 22). Миноксидил продлевает стадию анагена роста волос и вызывает увеличение и рост фолликулов в состоянии покоя. Он удлиняет и увеличивает мелкие пушковые волоски и уменьшает выпадение волос (21). Как он опосредует эти эффекты, неясно. Финастерид представляет собой ингибитор 5-α редуктазы 2 типа, который снижает уровень дигидротестостерона в сыворотке и коже и, следовательно, ингибирует андроген-зависимую миниатюризацию волосяных фолликулов (22).

Мыши с нокаутом рецептора витамина D характеризуются 1,25 (OH) 2 D 3 -резистентным рахитом с гипокальциемией, гипофосфатемией, гиперпаратиреозом, рахитом, остеомаляцией и алопецией (6, 23, 24). Перевод этих животных на диету с высоким содержанием кальция, фосфора и лактозы может нормализовать их фенотип, за исключением алопеции (23, 25). Кроме того, у людей с устойчивым к витамину D 3 рахит типа 2 имеет инактивирующую зародышевую линию мутацию VDR с частичной или полной алопецией (26).Исследования с использованием мышей с нокаутом VDR показали, что кератиноциты являются аберрантными клетками, ответственными за их фенотип без шерсти (23, 27). Кератиноциты экспрессируют Whn, и анализы восстановления волос показали, что они являются дефектным типом клеток в развитии волос у мышей nude (2). Исследования показали, что экспрессия нескольких генов кератина снижена в голой коже и что транскрипция гена кератина может регулироваться Whn (4, 28). В наших исследованиях мы показали, что лечение голых мышей аналогами витамина D 3 увеличивало экспрессию кератинов в их коже одновременно с ростом волос.Эти наблюдения предполагают, что аналоги витамина D 3 действуют временно, нормализуя кератиноциты голых мышей, что позволяет производить волосы.

Выщипывание волос вызывает начало новой фазы анагена волосяного фолликула. Наши эксперименты с использованием мышей C57 BL / 6 показали, что аналоги витамина D 3 не влияли на повторное появление волос после выщипывания. Это наблюдение предполагает, что аналоги витамина D 3 не влияют на индукцию анагена. Аналоги витамина D 3 , по-видимому, действуют ниже Whn, о чем свидетельствует их способность увеличивать экспрессию мРНК генов-мишеней Whn, кератина Ha1, Ha7, Ha8 и Hb3, в коже голых мышей.Ранее было показано, что 1,25 (OH) 2 D 3 активирует экспрессию кератина во время дифференцировки кератиноцитов (29), хотя этот эффект был косвенным (30). В кератиноцитах Whn экспрессируется на ранних стадиях терминальной дифференцировки, где он активирует маркеры ранней дифференцировки, такие как кератин 1 (4, 31). Наши наблюдения на голых мышах показывают, что лечение аналогами витамина D 3 способно преодолеть блокировку дифференцировки кератиноцитов, вызванную инактивацией Whn, что приводит к увеличению экспрессии кератина и образованию видимых волос.

Недавнее исследование продемонстрировало, что у пациента с мутировавшим VDR алопеция была неотличима от атрихии, вызванной мутациями в гене бесшерстности (32). Авторы пришли к выводу, что VDR и ген безволосости могут быть частью одного и того же или конвергентного генетического пути, необходимого для нормального цикла волос. У голых мышей аберрантный фенотип вызван дефектом катагена (33). Это повышает вероятность того, что аналоги витамина D 3 могут регулировать экспрессию генов, контролирующих катаген.

В наших экспериментах введение 1,25 (OH) 2 D 3 не вызывало роста волос у мышей nude; однако различные аналоги витамина D 3 действительно вызывали рост волос. Ранее было показано, что все эти аналоги обладают большей способностью вызывать дифференцировку и ингибировать пролиферацию различных типов клеток, связанных с раком, как in vitro, , так и in vivo (10-15) (Таблица 3). Следовательно, вероятная причина, по которой аналоги витамина D 3 способны стимулировать рост волос у голых мышей, тогда как 1,25 (OH) 2 D 3 не могут, заключается в том, что они обладают большей эффективностью in vivo .Каждый из аналогов способен связываться с VDR (9). Некоторые из механизмов, которые, как предполагается, объясняют их повышенную эффективность, включают тот факт, что они уменьшили связывание с D-связывающим белком в сыворотке, что обеспечивает более легкий доступ к проникновению в клетку. Эти аналоги могут изменять конформацию VDR, делая их более активными, или они могут увеличивать период полужизни активированного VDR (34). Они также могут модулировать способность корепрессоров или соактиваторов взаимодействовать с лиганд-активированным VDR (35).Каким бы ни был механизм, эти аналоги действуют на волосяной фолликул голых мышей, вероятно, за счет стимуляции экспрессии генов, таких как кератины, которые находятся ниже по течению от дефектного фактора транскрипции Whn; и эти гены имеют решающее значение для формирования стержня волоса (16, 17, 31). Таким образом, наши результаты убедительно доказывают, что аналоги витамина D 3 могут стимулировать рост волос у голых мышей, у которых обычно нет видимых волос.

Благодарности

Эта работа была частично поддержана семейным фондом Сида и Энн Шварц, Horn Trust и Parker Hughes Foundation.H.P.K. является заведующим кафедрой онкологии Марка Гудсона в медицинском центре Cedars Sinai и членом онкологического центра Йонссона.

Сокращения

  • BNX

  • 125 (OH) 2 D 3

  • VDR

1

Nehls

M

,

Pfeifer

D

D

Hedrich

H

,

Boehm

T

1994

Новый член семейства белков winged-helix, разрушенный при мутациях nude у мышей и крыс

.

Nature

372

:

103

107

2

Brissette

JL

,

Li

J

,

Kamimura

J

,

Lee

GP

1996

Продукт голого локуса мыши, Whn, регулирует баланс между ростом и дифференцировкой эпителиальных клеток

.

Genes Dev

10

:

2212

2221

3

Франк

J

,

Pignata

C

,

Пантелеев

AA

,

H DM

Prowse

,

Weiner

L

,

Gaetaniello

L

,

Ahmad

W

,

Pozzi

N

,

Cserhalmi-Friedman

PB

a H

,

Gordon

D

,

Ott

J

,

Brissette

JL

,

Christiano

AM

1999

Выявление фенотипа человеческого обнаженного тела

.

Nature

398

:

473

441

4

Schorpp

M

,

Schlake

T

,

Kreamalmeyer

D

000

Allen

2000

Генетически разделимые детерминанты экспрессии гена кератина волос

.

Dev Dyn

218

:

537

543

5

Schlake

T

,

Schorpp

M

,

Nehls

M

Boeh Ген nude кодирует специфичный для последовательности ДНК-связывающий белок с гомологами у организмов, у которых отсутствует упреждающая иммунная система

.

Proc Natl Acad Sci USA

94

:

3842

3847

6

Yoshizawa

T

,

Handa

Y

,

Uematsu

Y

a

K

,

Yoshihara

Y

,

Kawakami

T

,

Arioka

K

,

Sato

H

,

Uchiyama

000 Yukiyama

000 Ychiyama

A

,

Matsumoto

T

,

Kato

S

1997

У мышей, лишенных рецептора витамина D, после отлучения от груди

наблюдается нарушение костеобразования, гипоплазия матки и задержка роста.

Nat Genet

16

:

391

396

7

Reichrath

J

,

Schilli

M

,

Kerber

A 9000 C00030003

Bahmer 9000

,

Paus

R

1994

Экспрессия в волосяных фолликулах 1,25-дигидроксивитмина D 3 рецепторов во время цикла волос мышей

.

Br J Dermatol

131

:

477

482

8

Bikle

DD

,

Gee

E

,

Pillai

S

Регулирование роста и дифференциации 1993 года Метаболизм витамина D аналогами 1,25-дигидроксивитамина D3

.

J Invest Dermatol

101

:

713

718

9

Бульон

R

,

Okamura

WH

,

Norman

функция A

Взаимосвязи между витамином 1995 Эндокринная система D

.

Endocr Ред.

16

:

200

257

10

Hisatake

J

,

O’Kelly

J

,

Uskokovic

M

u

,

Koto3ffler

HP

2001

Новый витамин D 3 аналог, 21- (3-метил-3-гидроксибутил) -19-нор-D 3 , который модулирует рост клеток, дифференцировку, апоптоз, клеточный цикл , и индукция PTEN в лейкозных клетках

.

Кровь

97

:

2427

2433

11

Шиохара

M

,

Ускокович

M

,

Хисатаке

J

,

000

000 Хисатаке ,

Komiyama

A

,

Koeffler

HP

2001

24-оксо метаболиты аналогов витамина D3: устранение их выраженных антилейкемических эффектов из-за отсутствия модуляции кальция

.

Cancer Res

61

:

3361

3368

12

Lee

YY

,

Kim

ES

,

Seol

JG

,

BIM

up

Elstner

E

,

Park

DJ

,

Koeffler

HP

1996

Влияние аналога витамина D 3 , EB1089, на гемопоэтические стволовые клетки

миелобластов из нормальных и миелоидных лейкоцитов.

Лейкемия

10

:

1751

1757

13

Elstner

E

,

Linker-Israel

M

,

Саид

J

,

Umiel

S

,

Shintaku

IP

,

Heber

D

,

Binderup

L

,

Uskokovic

M

,

Koeffler

EP

3 аналогов: новый класс сильнодействующих ингибиторов пролиферации и индукторов дифференцировки линий клеток рака молочной железы человека

.

Cancer Res

55

:

2822

2830

14

Koike

M

,

Koshisuzuka

K

,

Sawabata

H

000

, Y

,

Said

J

,

Uskokovic

M

,

Tsuruoka

N

,

Koeffler

HP

1999

аналог витамина D 9017 циклопропил-9017 мощные ингибиторы пролиферации клеточных линий простаты, груди и миелоидного лейкоза человека

.

Anticancer Res

19

:

1689

1698

15

Kubota

T

,

Koshizuka

K

,

Koike

M

hi

000

M

,

Koeffler

HP

1998

19-нор-26, 27-бисомовитамин D 3 аналогов: уникальный класс мощных ингибиторов пролиферации раковых клеток простаты, груди и кроветворных клеток

.

Cancer Res

58

:

3370

3375

16

Rogers

MA

,

Winter

H

,

Wolf

C

,

Heck

M

1998

Характеристика парного домена из 190 килобаз генов кератина волос типа I человека

.

J Biol Chem

273

:

26683

26691

17

Langbein

L

,

Rogers

MA

,

Winter

H

,

H Praetzel

J

2001

Каталог кератинов человеческого волоса.II. Экспрессия шести членов типа II в волосяном фолликуле и объединенный каталог человеческих кератинов I и II типа

.

J Biol Chem

276

:

35123

35132

18

Fuchs

E

,

Merrill

BJ

,

Jamptora

C

,

В основе нескончаемого цикла

.

Dev Cell

1

:

13

25

19

Sawaya

ME

,

Penneys

NS

1992

Иммуногистохимическое распределение ароматазы фолиевой кислоты человека и волосяной деформации 3B сальник

.

J Cutan Pathol

19

:

309

314

20

Hodgins

MB

,

Murad

S

1986

25-дигидрооксиэстинэстинэстиновый холестерин в коже человека стимулирует превращение 25-дигидро-оксихолекулярных фибробластов в кожу человека культура

.

J Эндокринол

110

:

R1

R4

21

DuCharme

DW

,

Freyburger

WA

,

Graham

000

000 R7

000

BE

000

Свойства миноксидила: новое гипотензивное средство

.

J Pharmacol Exp Ther

184

:

662

670

22

McClellan

KJ

,

Markham

A

1999

Finasteride анализ облысения при выпадении волос у мужчин. .

Наркотики

57

:

111

126

23

Sakai

Y

,

Kishimoto

J

,

Demay

MB

2001

клеточный анализ метаболизма

9000 рецепторы мышей с нокаутом

.

J Clin Invest

107

:

961

966

24

Li

YC

,

Pirro

AE

,

Amling

M

,

9000 Barber

R

,

Bronson

R

,

Demay

MB

1997

Целевое удаление рецептора витамина D: животная модель витамин D-зависимого рахита II типа с алопецией

.

Proc Natl Acad Sci USA

94

:

9831

9835

25

Li

YC

,

Amling

M

,

Pirro

AE

000 M

000 M

J

,

Baron

R

,

Delling

G

,

Demay

MB

1998

Нормализация гомеостаза минеральных ионов с помощью диетических средств предотвращает гиперпаралопеидизм, ахиторию и рак Мыши с удаленными рецепторами витамина D

.

Эндокринология

139

:

4391

4396

26

Hewison

M

,

O’Riordan

JLH

1994

Устойчивость к витамину D

.

Baillieres Clin Endocrinol Metab

9

:

305

315

27

Chen

CH

,

Sakai

Y

,

Demay

MB

2001

экспрессия человека Рецептор D кератиноцитов мышей с нулевым рецептором витамина D предотвращает алопецию

.

Эндокринология

142

:

5386

5392

28

Schlake

T

,

Schorpp

M

,

Maul-Pavicic

A

000

000

000

000 AM

000

000

000 AM

000

T

2000

Фактор транскрипции «вилка / крылатая спираль» Whn регулирует экспрессию гена кератина волос: молекулярный анализ фенотипа «голой» кожи

.

Dev Dyn

217

:

368

376

29

Hosomi

J

,

Hosoi

J

,

Abe

E

,

000 T

Suda

000

1983

Регуляция терминальной дифференцировки культивируемых эпидермальных клеток мыши с помощью 1,25-дигидроксивитамина D3

.

Эндокринология

113

:

1950

1957

30

Блюменберг

M

,

Коннолли

DM

,

Freedberg

IW

Регулирование экспрессии гена IW

Роль ядерных рецепторов гормонов ретиноевой кислоты, гормона щитовидной железы и витамина D3

.

J Invest Dermatol

98

:

42

S – 49S31

Baxter

RM

,

Brissette

JL

2002

Роль голого гена в терминальной дифференцировке эпителия

.

J Invest Dermatol

118

:

303

309

32

Миллер

J

,

Джабали

K

,

Chen

T

000

000 Liu

Liu

M

,

Lyle

S

,

Christiano

AM

,

Holick

M

,

Cotsarelis

G

2001

Атрихия, вызванная мутациями в гене генерализованного фенокартона D. atrichia, вызванные мутациями в гене безволосого

.

J Invest Dermatol

117

:

612

617

33

Пантелеев

AA

,

Бочкарева

NV

,

Sundberg

JP

Paus

R

1999

Роль гена безволосого (hr) в регуляции катагеновой трансформации волосяного фолликула

.

Am J Pathol

155

:

159

171

34

Van den Bemd

GC

,

Pols

HA

,

Birkenhager

en JC

,

,

1996

Изменение конформации и усиленная стабилизация рецептора витамина D с помощью аналога 1,25-дигидроксивитамина D3 KH 1060

.

Proc Natl Acad Sci USA

93

:

10685

10690

35

Campbell

MJ

,

Koeffler

HP

1997

На пути к терапевтическому вмешательству витаминов D.

J Национальное онкологическое учреждение

89

:

182

186

Авторские права © 2002, Общество эндокринологов

Сделайте ваши волосы быстрее с помощью этих 9 витаминов и минералов, потому что здоровые пряди исходят от здорового человека

Итак, вы хотите отрастить более длинные волосы.Несмотря на то, что в основном это просто игра на ожидание, на самом деле есть несколько вещей, которые вы можете сделать, чтобы ваши волосы росли с максимально возможной скоростью. Конечно, нужно регулярно подстригать, чтобы секущиеся кончики не выглядели так, как будто они не растут. Вы также можете попытаться ограничить вредные привычки, такие как химическая обработка, тепловая укладка и даже плетение волос. Но иногда наибольшую помощь может оказать что-то более простое — ваше здоровье.

Если желаемая длина не получается, обратите внимание на ежедневное потребление витаминов и минералов.Относительно здоровая диета играет важную роль в росте здоровых волос, поскольку эти питательные вещества так же полезны для ваших волос, как и для всего тела. Но если вы чувствуете, что просто не получаете все необходимое, попробуйте включить поливитамины или индивидуальные витаминные добавки в свой ежедневный рацион. Это поможет сделать волосы более длинными и крепкими. Если вы предпочитаете идти естественным путем, вот некоторые из самых важных витаминов и минералов для роста волос, а также продукты, в которых они есть.

Витамин A

Дэн Китвуд / Getty Images News / Getty Images

Витамин A необходим для роста клеток. Он также способствует выработке здорового кожного сала в коже головы, что предотвращает высыхание прядей. Его можно найти во фруктах и ​​овощах, таких как дыня, персики, шпинат и морковь. Вот в чем дело, Док.

Биотин

Шон Гэллап / Getty Images News / Getty Images

Биотин не только увеличивает густоту волос, но и помогает производить больше волос.Его можно найти в таких продуктах, как коричневый рис, горох, чечевица и овес.

Витамин C

Sandra Mu / Getty Images News / Getty Images

Витамин C отвечает за выработку коллагена, который важен для укрепления волос и улучшения их роста. Его можно найти в таких фруктах, как черника, клубника, киви и апельсины.

Витамин D

Шон Гэллап / Getty Images News / Getty Images

Витамин D способствует здоровому росту фолликулов, уменьшая выпадение волос.Его особенно можно найти в молочных продуктах, таких как молоко, йогурт и сыр. Если вы не получаете достаточного количества витамина D из своего рациона, обязательно проводите около 10-15 минут на улице каждый день, так как вы также можете получить витамин D от солнца.

Витамин E

Джастин Салливан / Getty Images News / Getty Images

Витамин E может предотвратить выпадение волос, помогая сохранить здоровье кожи головы. Его можно найти в таких продуктах, как бобы, соевые бобы, листовая зелень и орехи.

Железо

Джастин Салливан / Getty Images News / Getty Images

Железо помогает клеткам, производящим волосы, работать изо всех сил, облегчая передачу кислорода клеткам.Его можно найти в таких продуктах, как красное мясо, птица и яйца.

Магний

Фил Уолтер / Getty Images News / Getty Images

Магний способствует здоровью кожи головы, созданию сильных и здоровых волос. Его можно найти в таких продуктах, как семена, орехи, лосось и дикий рис.

Ниацин

Скотт Олсон / Getty Images News / Getty Images

Ниацин питает кожу головы, стимулируя кровообращение, что приводит к здоровому росту волос. Его можно найти в таких продуктах, как рыба, курица, свинина и арахис.

Цинк

Джо Рэдл / Getty Images News / Getty Images

Цинк восстанавливает поврежденные волосковые клетки, а также сохраняет сальные железы, окружающие фолликулы, в идеальной форме. Его можно найти в таких продуктах, как устрицы, красное мясо и крупы. Так что да, длинные и здоровые волосы могут быть волшебным образом восхитительны (хотя вам, вероятно, лучше выбрать что-то, в котором немного меньше сахара).

Изображения: ramonespelt / Fotolia; Getty Images (9)

Лучшие витамины для роста волос для укрепления истонченных волос

Истончение волос — это факт жизни.Независимо от того, насколько сочными, казалось бы, всегда были ваши локоны, в тот или иной момент этот объем будет уменьшаться (для некоторых больше, чем для других). И, как и многое из того, что происходит в нашем организме, это связано с генами.

«В какой-то момент наши волосы начинают редеть», — объясняет дерматолог Мона Гохара, доктор медицины, доцент клинической школы Йельской школы медицины. «Это может произойти в раннем возрасте (в подростковом возрасте или в возрасте 20 лет для некоторых), но чаще всего происходит в возрасте чуть более 30 лет». Возникновение наследственное.Это очень похоже на появление седых волос — если это случилось с вашими родителями в определенном возрасте, это, вероятно, случится и с вами примерно в то же время. Вы можете заметить более широкую щель в части волос или отступающую назад линию роста волос.

Помимо генов, стресс также имеет большое значение. Но, к счастью, поскольку вы можете следить за стрессом, доктор Гохара уверяет, что тип линьки обычно меняется на противоположный.

А один из других наиболее известных виновников выпадения волос? Недостаток витаминов. Дерматолог Ноелани говорит, что если вам не хватает питательных веществ, вы придерживаетесь определенной диеты или страдаете заболеванием, лишающим вас этих витаминов, вы можете начать замечать рост прядей на полу в душе. Гонсалес, доктор медицины.

Хотя нет убедительных доказательств того, что какой-либо один витамин ускорит рост (или отрастание) ваших волос, существует исследований, исследований, которые связывают витамины с различными типами выпадения волос и здоровьем фолликулов, говорит Гонсалес. (Перевод: если вы не получите их достаточно, вы можете испытать выпадение волос.) Вы, наверное, слышали о них:

  • Витамины группы B : «Продукты, богатые витаминами группы B, помогают здоровью волос. и обновление клеток, необходимых для роста волос », — объясняет Вандана Шет, RDN, зарегистрированный диетолог из Лос-Анджелеса и автор книги My Indian Table: Quick & Tasty Vegetarian Recipes. Хорошие источники витаминов группы B включают цельнозерновые, темные листовые овощи, морепродукты и мясо.
  • Витамин D : «Это витамин, который помогает поддерживать общий иммунитет», — говорит д-р Гохара. Только недавно это было связано со здоровьем волос. По ее словам, люди с более высокой вероятностью дефицита витамина D — это люди с коричневой кожей, живущие в более холодном климате без достаточно сильного ультрафиолета.
  • Омега-3 жирные кислоты : Эти жиры являются «хорошим источником белка, который может помочь повысить прочность ваших прядей», — объясняет Шет.Некоторые хорошие источники включают лосось, тунец, скумбрию, сардины, семена чиа, льняную муку и грецкие орехи.
  • Цинк : Этот препарат был связан с борьбой с дрожжами, вызывающими перхоть, воспаление и выпадение волос в виде избыточного выпадения, говорит доктор Гохара.
  • Железо : «Люди с дефицитом железа могут страдать от анемии и последующей потери волос», — объясняет д-р Гохара. «Это может произойти с диетами, в которых отсутствует железо, с тяжелыми менструальными циклами, когда значительна кровопотеря, или с другими состояниями здоровья.«
  • B12 : Мясо обычно содержит этот витамин, поэтому у тех, кто придерживается вегетарианской диеты и замечает истончение волос, также могут быть ломкие и сухие волосы, — говорит доктор Гохара.
  • Биотин : Скорее всего, вы» Я пробовал эту добавку раньше. Когда-то она была известна как Святой Грааль для волос, кожи и ногтей. Но доктор Гохара объясняет, что теперь она перестала быть популярной из-за отсутствия научных подтверждений утверждений о ней.
  • Витамин E: Было обнаружено, что это питательное вещество предотвращает окислительный стресс, говорит Шет.Хорошие источники: авокадо, семена подсолнечника, миндаль и шпинат.

«Добавки для роста волос и некоторые из этих витаминов могут быть полезны для тех пациентов, которые испытывают истончение, выпадение волос и / или не получают достаточного количества определенных витаминов», — говорит доктор Гонсалес. «Вы можете думать о витаминных добавках как о снабжении ваших волос необходимыми ингредиентами, чтобы они могли развиваться здоровым образом».

Но будьте осторожны: если у вас на самом деле нет витаминов, не удивляйтесь, если эти добавки не имеют большого значения.И если вы не уверены в своем отношении к потреблению витаминов, посоветуйтесь со своим врачом. Они могут порекомендовать анализ крови, чтобы определить, чего вам не хватает.

Впереди вы найдете те, которые были предварительно проверены профессионалами специально для вас.

Контролируемое клиническое испытание для оценки роста волос с использованием низких доз циклической нутритивной терапии у мужчин и женщин без использования финастерида

  • 1. Гуаррера М., Ребора А. Волосы анагена могут не заменять телогенные волосы при ранней андрогенной женской алопеции.Дерматология 1996; 192: 28-31.

    DOIPubMed
  • 2. Гуаррера М., Ребора А. Кеноген в женской андрогенной алопеции. Продольное исследование. Дерматология 2005; 210: 18-20.

    DOIPubMed
  • 3. Trüeb RM. Telogen Effluvium: есть ли необходимость в новой классификации? Расстройство придатков кожи 2016; 2: 39-44.

    DOIPubMed PMC
  • 4. Клигман AM. Патологическая динамика облысения человека. I. Telogen effuvium. Arch Dermatol 1961; 83: 175-98.

    DOIPubMed
  • 5.Рук А., Доубер Р. Глава 5. Диффузная алопеция: эндокринные, метаболические и химические влияния на фолликулярный цикл. В: Rook A, Dawber R, ред. Заболевания волос и кожи головы. Оксфорд, Великобритания: Научные публикации Блэквелла; 1982. С. 115–45.

  • 6. Headington JT. Телогеновый отток. Новые концепции и обзор. Arch Dermatol 1993; 129: 356-63.

    DOI
  • 7. Паус Р., Котсарелис Г. Биология волосяных фолликулов. N Engl J Med 1999; 341: 491-7.

    DOIPubMed
  • 8.Liyanage D, Sinclair R. Telogen effluvium. Косметика 2016; 3:13.

    DOI
  • 9. Chen W., Thiboutot D., Zouboulis CC. Кожный метаболизм андрогенов: фундаментальные исследования и клинические перспективы. Дж. Инвест Дерматол 2002; 119: 992-1007.

    DOIPubMed
  • 10. Хоффманн Р., Хэппл Р. Современное понимание андрогенетической алопеции. Часть II: клинические аспекты и лечение. Eur J Dermatol 2000; 10: 410-7.

    PubMed
  • 11. Гриффин Дж. Э., Уилсон Дж. Д.. Метаболическая основа наследственного заболевания.Синдромы резистентности: недостаточность 5альфа-редуктазы, феминизация яичек и родственные нарушения. Нью-Йорк: Макгроу-Хилл; 1989. С. 1919-44.

  • 12. Савая М.Е., Цена ВХ. Различные уровни 5альфа-редуктазы I и II типа, ароматазы и рецептора андрогенов в волосяных фолликулах женщин и мужчин с андрогенной алопецией. Дж. Инвест Дерматол 1997; 109: 296-300.

    DOI
  • 13. Берч М.П., ​​Мессенджер Дж. Ф., Мессенджер АГ. Плотность, диаметр волос и распространенность облысения по женскому типу.Br J Dermatol 2001; 144: 297-304.

    DOIPubMed
  • 14. Норвуд ОТ. Заболеваемость женской андрогенной алопецией (алопеция по женскому типу). Dermatol Surg 2001; 27: 53-4.

    PubMed
  • 15. Lengg N, Heidecker B, Seifert B, Trüeb RM. Пищевая добавка увеличивает скорость роста волос в анагене у женщин с телогеновой алопецией: результаты двойного слепого плацебо-контролируемого исследования. Терапия 2007; 4: 59-65.

    DOI
  • 16. Орм С., Каллен Д. Р., Messenger AG. Диффузное выпадение волос у женщин: нужны ли андрогены? Br J Dermatol 1999; 141: 521-3.

    DOIPubMed
  • 17. Cousen P, Messenger A. Выпадение волос по женскому типу при синдроме полной нечувствительности к андрогенам. Br J Dermatol 2010; 162: 1135-7.

    DOIPubMed
  • 18. Урысяк-Чубатка И., Кмич М.Л., Брониарчик-Дила Г. Оценка эффективности дигидротестостерона в диагностике пациентов с андрогенной алопецией. Постэпы Дерматол Алергол 2014; 31: 207-15.

    DOIPubMed PMC
  • 19. Вольф Х., Фишер Т.В., Блюм-Пейтави У. Диагностика и лечение заболеваний волос и кожи головы.Dtsch Arztebl Int 2016; 113: 377-86.

    PubMed PMC
  • 20. Trüeb RM. Фармакологические вмешательства при старении волос. Clin Interv Aging 2006; 1: 121-9.

    DOIPubMed PMC
  • 21. Goette DK, Odom RB. Алопеция у людей, сидящих на экстремальной диете. JAMA 1976; 235: 2622-3.

    DOI
  • 22. Fiedler VC, Gray AC. Глава 10. Диффузная алопеция: телогеновое выпадение волос. В кн .: Olsen EA, ed. Нарушения роста волос: диагностика и лечение. 2-е изд. Нью-Йорк, штат Нью-Йорк: издательство McGraw-Hill Publishing; 2003 г.С. 303-20.

  • 23. Sinclair RD, Dawber RP. Андрогенетическая алопеция у мужчин и женщин. Clin Dermatol 2001; 19: 167-78.

    DOI
  • 24. Раджпут Р. Понимание выпадения волос из-за загрязнения воздуха и подход к управлению. Трансплантация волос Ther 2015; 5: 133.

  • 25. Раджпут RS. Получите пользу от витаминной терапии для волос курильщика. Трансплантация волос Ther 2016; 6: 141.

  • 26. Синклер Р. Диффузное облысение. Int J Dermatol 1999; 38 Дополнение 1: 8-18.

    DOIPubMed
  • 27. Lee WS, Lee HJ. Характеристики андрогенной алопеции у азиатов. Энн Дерматол 2012; 24: 243-52.

    DOIPubMed PMC
  • 28. Bahta AW, Farjo N, Farjo B, Philpott MP. Преждевременное старение облысевших клеток дермального сосочка in vitro связано с экспрессией p16 (INK4a). Дж. Инвест Дерматол 2008; 128: 1088-94.

    DOIPubMed
  • 29. Харрисон С., Синклер Р. Выделение телогена. Clin Exp Dermatol 2002; 27: 389-95.

    ДОИПубМед
  • 30.Устунер ЭТ. Причина андрогенной алопеции: суть дела. Plast Reconstr Surg Glob Open 2013; 1: e64.

    DOIPubMed PMC
  • 31. Кауфман К.Д. Андрогены и алопеция. Mol Cell Endocrinol 2002; 198: 89-95.

    DOI
  • 32. Савая М.Э., Цена ВХ. Различные уровни 5альфа-редуктазы I и II типа, ароматазы и рецептора андрогенов в волосяных фолликулах женщин и мужчин с андрогенной алопецией. Дж. Инвест Дерматол 1997; 109: 296-300.

    DOI
  • 33. Chen W., Thiboutot D., Zouboulis CC.Кожный метаболизм андрогенов: фундаментальные исследования и клинические перспективы. Дж. Инвест Дерматол 2002; 119: 992-1007.

    DOIPubMed
  • 34. Хоффманн Р., Хэппл Р. Современное понимание андрогенной алопеции. Часть II: клинические аспекты и лечение. Eur J Dermatol 2000; 10: 410-7.

    PubMed
  • 35. Инадоми Т. Эффективность финастерида для лечения пациентов с андрогенетической алопецией, которые имеют гной в других областях: пилотное исследование в Японии. Индийский журнал J Dermatol 2014; 59: 163-5.

    DOIPubMed PMC
  • 36. Прайс В. Х., Робертс Дж. Л., Хордински М., Олсен Э. А., Савин Р., Бергфельд В., Фидлер В., Лаки А., Уайтинг Д. А., Папас Ф., Калбертсон Дж., Котей П., Михан А., Вальдштрайхер Дж. Недостаточная эффективность финастерида у женщин в постменопаузе с андрогенной алопецией. J Am Acad Dermatol 2000; 43: 768-76.

    DOIPubMed
  • 37. Кауфман К.Д., Олсен Э.А., Уайтинг Д., Савин Р., ДеВиллез Р., Бергфельд В., Прайс В. Х., Ван Несте Д., Робертс Дж. Л., Хордински М., Шапиро Дж., Бинковиц Б., Гормли Дж. Дж.Финастерид в лечении мужчин с андрогенной алопецией. Группа по изучению выпадения волос по мужскому типу финастерида. J Am Acad Dermatol 1998; 39: 578-89.

    DOI
  • 38. Irwig MS. Стойкие побочные эффекты финастерида на половую жизнь: могут ли они быть постоянными? J Sex Med 2012; 9: 2927-32.

    DOIPubMed
  • 39. Трэйш А.М., Хассани Дж., Гуай А.Т., Зицманн М., Хансен М.Л. Неблагоприятные побочные эффекты терапии ингибиторами 5α-редуктазы: стойкое снижение либидо, эректильная дисфункция и депрессия у части пациентов.Дж. Секс Мед 2011; 8: 872-84.

    DOIPubMed
  • 40. Eun HC. Участие ROS в регуляции андроген-индуцируемого TGF beta 1, происходящего из клеток дермального сосочка; предполагаемое влияние ROS на андрогенетическую алопецию. J Am Academy Dermatol 2008; 58: AB84.

  • 41. Шин Х., Ю Х. Г., Инуи С., Итами С., Ким И. Г., Чо А. Р., Ли Д.Х., Пак В.С., Квон О, Чо К.Х., Вон СН. Индукция трансформирующего фактора роста-бета 1 андрогеном опосредуется активными формами кислорода в клетках дермального сосочка волосяного фолликула.BMB Rep 2013; 46: 460-4.

    DOIPubMed PMC
  • 42. Trüeb RM. Молекулярные механизмы андрогенетической алопеции. Эксперимент Геронтол 2002; 37: 981-90.

    DOI
  • 43. Гётте Д.К., Одом РБ. Алопеция у людей, сидящих на экстремальной диете. JAMA 1976; 235: 2622-3.

    DOI
  • 44. Бетси А., Бинита М., Сарита С. Дефицит цинка, связанный с гипотиреозом: недооцененная причина тяжелой алопеции. Int J Trichol 2013; 5: 40-2.

    DOIPubMed PMC
  • 45. Озтурк П., Курутас Е., Атасевен А., Докур Н., Гумусалан Ю., Горур А., Тамер Л., Иналоз С.ИМТ и уровни цинка, меди в волосах, сыворотке и моче турецких пациентов мужского пола с андрогенной алопецией. Журнал J Trace Elem Med Biol 2014; 28: 266-70.

    DOIPubMed
  • 46. Яворски С., Клигман А.М., Мерфи Г.Ф. Характеристика воспалительных инфильтратов при облысении по мужскому типу: значение для патогенеза. Br J Dermatol 1992; 127: 239-46.

    DOIPubMed
  • 47. Янг Дж. У., Конте Е. Т., Ливитт М. Л., Нафц М. А., Шретер А. Л.. Кожная иммунопатология андрогенной алопеции.J Am Osteopath Assoc 1991; 91: 765-71.

    PubMed
  • 48. Rajendrasingh JR. Роль неандрогенных факторов в выпадении и возобновлении роста волос. J Cosmo Trichol 2017; 3: 118.

  • 49. Раджпут Р. Концепция циклической диетотерапии для роста волос, которая может применяться для оздоровления. J Nutr Food Sci 2017; 7: 615.

    DOI
  • 50. Roughead ZK, Zito CA, Hunt JR. Ингибирующие эффекты пищевого кальция на начальное поглощение и последующее удержание гемового и негемового железа у людей: сравнения с использованием метода кишечного лаважа.Am J Clin Nutr 2005; 82: 589-97.

    PubMed
  • 51. Браун Е.Б. младший, Дубач Р., резюме Мура. Исследования транспорта и метаболизма железа. XI. Критический анализ блока слизистой оболочки большими дозами неорганического железа у людей. J Lab Clin Med 1958; 52: 335-55.

    PubMed
  • 52. Холливелл Б. Антиоксиданты в здоровье и болезнях человека. Анну Рев Нутр 1996; 16: 33-50.

    DOIPubMed
  • 53. Холливелл Б. Парадокс антиоксидантов. Ланцет 2000; 355: 1179-80.

    ДОИ
  • 54.Ван Л., Ли Кью, Дуань XL, Чанг Ю.З. Влияние концентрации внеклеточного железа на абсорбцию кальция и взаимосвязь между Ca2 + и апоптозом клеток в клетках Caco-2. Мировой журнал J Gastroenterol 2005; 11: 2916-21.

    DOIPubMed PMC
  • 55. Мейдани М. Антиоксиданты в профилактике хронических заболеваний. Nutr Clin Care 2002; 5: 47-9.

    DOIPubMed
  • 56. Рутковский М., Гжегорчик К. Побочные эффекты антиоксидантных витаминов. Int J Occup Med Environ Health 2012; 25: 105-21.

    DOIPubMed
  • 57. Barzel US, Massey LK. E Избыток пищевого белка может отрицательно сказаться на костях. J Nutr 1998; 128: 1051-3.

    PubMed
  • 58. Linkswiler HM, Zemel MB, Hegsted M, Schuette S. Гиперкальциурия, индуцированная белком. Fed Proc 1981; 40: 2429-33.

    PubMed
  • 59. Kerstetter JE, Allen LH. Пищевой белок увеличивает содержание кальция в моче. J Nutr 1990; 120: 134-6.

    PubMed
  • 60. Ито Р., Нишияма Н., Суяма Ю. Потребление белка с пищей и экскреция кальция с мочой: поперечное исследование среди здорового японского населения.Am J Clin Nutr 1998; 67: 438-44.

    PubMed
  • 61. Эвертс HB. Эндогенные ретиноиды в волосяном фолликуле и сальной железе. Biochim Biophys Acta 2012; 1821: 222-9.

    DOIPubMed PMC
  • 62. Фойцик К., Спексард Т., Накамура М., Халснер У., Паус Р. К анализу патогенеза выпадения волос, вызванного ретиноидами: полностью транс-ретиноевая кислота вызывает преждевременную регрессию волосяных фолликулов (катаген) за счет активации трансформирующий фактор роста-бета2 в дермальный сосочек. Дж. Инвест Дерматол 2005; 124: 1119-26.

    DOIPubMed
  • 63. Финнер AM. Питание и волосы: недостатки и добавки. Дерматол Клин 2013; 31: 167-72.

    DOIPubMed
  • 64. Rushton DH. Факторы питания и выпадение волос. Clin Exp Dermatol 2002; 27: 396-404.

    DOIPubMed
  • 65. Guo EL, Katta R. Диета и выпадение волос: последствия дефицита питательных веществ и использования добавок. Концепция Dermatol Pract 2017; 7: 1-10.

    PubMed PMC
  • 66. Эритсланд Дж. Вопросы безопасности полиненасыщенных жирных кислот.Am J Clin Nutr 2000; 71: S197-201.

  • 67. Харпер А.Е. Происхождение рекомендуемых диетических добавок — исторический обзор. Am J Clin Nutr 1985; 41: 140-8.

    PubMed
  • 68. Спиричев В.Б. Научное обоснование использования витаминов в профилактических и лечебных целях. Доклад 1. Недостаток витаминов в рационе современного человека: причины, последствия и коррекция. Вопр Питан 2010; 79: 4-14. (на русском).

    PubMed
  • 69. Пиво C, Wood S, Veghte RH.Клиническое испытание для изучения влияния Cynatine HNS на параметры волос и ногтей. Научный мировой журнал 2014; 2014: 641723.

    DOIPubMed PMC
  • 70. Райзер Р. Л., Стивенс Т. Дж., Херндон Дж. Х., Спербер Б. Р., Мерфи Дж., Аблон Г. Р.. Пищевая добавка на основе морского белка для лечения субклинического истончения / выпадения волос: результаты мультицентрового двойного слепого плацебо-контролируемого клинического исследования. Int J Trichology 2015; 7: 156-66.

    DOIPubMed PMC
  • 71. Николс AJ, Hughes OB, Canazza A, Zaiac MN.Открытый оценщик закрыл слепое исследование эффективности и безопасности новой пищевой добавки при андрогенетической алопеции: пилотное исследование. Журнал J Clin Aesthet Dermatol 2017; 10: 52-6.

    PubMed PMC
  • 72. Раджпут Р.Дж. Циклическая медицина для лечения выпадения волос и улучшения результатов при трансплантации волос. Форум по пересадке волос Int 2008; 18: 208-10.

  • 73. Раджпут Р.Дж. Противоречие: есть ли роль адъювантов в лечении облысения по мужскому типу? Дж. Кутан Эстет Сург 2010; 3: 82-6.

    PubMed PMC
  • 74. Раджпут Р. Уменьшение облысения и улучшение качества волос с помощью витаминной терапии монилетриксом. J Cosmo Trichol 2016; 2: 113.

    DOI
  • 75. Раджпут Р. Выпадение волос из-за электромагнитного излучения из-за чрезмерного использования сотового телефона. J Cosmo Trichol 2016; 2: 114.

    DOI
  • 76. Olsen EA, Dunlap FE, Funicella T, Koperski JA, Swinehart JM, Tschen EH, Trancik RJ. Рандомизированное клиническое испытание 5% миноксидила для местного применения в сравнении с 2% миноксидилом для местного применения и плацебо при лечении андрогенетической алопеции у мужчин.J Am Acad Dermatol 2002; 47: 377-85.

    DOIPubMed
  • 77. Sarris J, Cox KH, Camfield DA, Scholey A, Stough C, Fogg E, Kras M, White DJ, Sali A, Pipingas A. Опыт участников хронического приема поливитаминов по сравнению с плацебо на субъективное состояние здоровья и благополучие: двойной слепой качественный анализ рандомизированного контролируемого исследования. Нутр Ж 2012; 11: 110.

    DOIPubMed PMC
  • 20 лучших продуктов для роста волос

    Медицинский осмотр: Mat Rezaei
    Pharm.D., RPH, CEO-UPHEALTH
    Написано редакцией UPGUYS
    Опубликовано 16 ноября 2021 г.

    Независимо от пола, многие из нас ищут густые длинные волосы в изобилии, и мы считаем это высшей целью красоты.Если вы погуглили «что мне есть, чтобы ускорить рост волос» и остановились здесь, есть хорошие новости. Где воля, там и выход!

    В данном конкретном случае есть 20 рекомендуемых продуктов, которые помогут вам сделать ваши волосы здоровыми и красивыми.

    Без лишних слов, давайте углубимся.

    Список всех вещей, которые вам нужны для здоровья тела и волос

    Такие факторы, как возраст , генетика, и гормоны могут влиять на рост волос , но мы можем контролировать то, что мы едим.Итак, давайте познакомимся с питательными веществами, которые способствуют росту волос.

    Биотин

    Биотин (также известный как витамин H) — это витамин B. Если быть более точным, это витамин B7, который помогает нашему телу преобразовывать пищу в энергию и может способствовать росту и укреплению волос. Биотин содержится в яичном желтке, печени и дрожжах.

    Биотин — это водорастворимый витамин, поэтому любой лишний биотин в нашем организме будет вымываться с мочой.

    Витамин B12

    Как и биотин, витамин B12 способствует здоровому росту волос, производя богатые кислородом эритроциты и питая волосяные фолликулы.

    Витамин B12 содержится только в продуктах животного происхождения, поэтому веганы или вегетарианцы могут не получать его в достаточном количестве. Хорошей новостью является то, что добавки с витамином B12 на растительной основе помогают веганам и вегетарианцам получать достаточно B12, не употребляя продукты животного происхождения.

    Витамин B12, ресурсы животного и растительного происхождения

    Нет никаких рисков, связанных с добавками витамина B12, потому что любое избыточное количество в нашем организме вымывается естественным путем.

    Витамин D

    Витамин D стимулирует новые и старые волосяные фолликулы.Рост новых волос может быть затруднен, если в вашем организме недостаточно витамина D. Дефицит витамина D может вызвать алопецию — состояние, при котором на коже головы появляются залысины.

    Витамин E

    Наличие в организме достаточного количества витамина E необходимо для здоровья кожи головы. Витамин Е поддерживает кожу головы, одновременно обеспечивая сильную основу для роста волос, уменьшая окислительный стресс в коже головы и защищая липидный слой.

    Дефицит витамина Е встречается довольно редко, потому что большинство из нас получают его в достаточном количестве благодаря сбалансированной диете.

    Витамин C

    Витамин C — мощный антиоксидант, который помогает защитить от окислительного стресса, вызванного свободными радикалами. Он также помогает организму усваивать железо — еще одно питательное вещество, необходимое для роста волос.

    Клубника, перец, гуава и цитрусовые — отличные источники витамина С.

    Витамин С во фруктах

    Железо

    Дефицит железа связан с выпадением волос, и ваш врач может прописать вам добавки с железом для лечить это состояние.

    Омега-3 жирные кислоты

    Противовоспалительные эффекты омега-3 жирных кислот могут противодействовать любому воспалению, вызывающему выпадение волос.

    Вот список продуктов, которые улучшают ваши волосяные фолликулы.

    Продукты для роста волос

    1- Лосось

    Лосось полон полезных для здоровья омега-3 жирных кислот . Вы не можете вырабатывать эти полезные жиры в своем теле; вы должны получать их из пищевых добавок.

    Омега-3 жирные кислоты помогают не только защитить себя от болезней, но и помогают волосам расти и сиять.

    2- Греческий йогурт

    Греческий йогурт содержит белков и витамин B5 , что означает, что он поможет вашим волосам стать сильнее и улучшит приток крови к коже головы.

    3- Шпинат

    Шпинат, как и многие другие темно-зеленые листовые овощи, полон необходимых питательных веществ. В шпинате много витамина А и витамина С , железа , фолиевой кислоты, и бета-каротина . Все эти питательные вещества помогут вам иметь здоровую кожу головы для роста волос.

    4- Капуста

    Как и шпинат, капуста — еще один прекрасный зеленый листовой овощ, богатый питательными веществами. Высокое количество витамина C в капусте помогает вырабатывать коллаген, который очень важен для роста волос.

    5- Гуава

    Гуава — тропический фрукт, который не только восхитителен, но и полон витамина C . Помимо других преимуществ витамина С, он защищает волосы от ломкости и помогает им становиться длиннее и сильнее.

    6- Говядина

    Говядина, особенно субпродукты, такие как печень, богаты белком и железом , важными для здоровья и роста волос.

    7- Зерновые, обогащенные железом

    Дефицит железа может привести к выпадению волос. Как упоминалось выше, , железо, , содержится в мясе, но если вы придерживаетесь диеты, запрещающей употребление мяса животных, вы все равно можете найти это жизненно важное питательное вещество в обогащенных злаках, зернах, макаронах, соевых бобах и чечевице.

    Ресурсы на основе растений железа

    8- Устрицы

    Устрицы относятся к продуктам, богатым цинком , а цинк участвует в росте волос и поддерживает работу сальных желез вокруг стержня волоса.Низкий уровень цинка может вызвать перхоть, замедление роста и даже выпадение волос.

    9- Моллюски

    Моллюски, как и говядина, являются отличным источником железа .

    10- Курица и индейка

    Нежирная птица — отличный вариант для получения белка в своем рационе. Курица или индейка содержат весь необходимый белок, но при этом содержат меньше насыщенных жиров, чем другие источники белка, такие как говядина или свинина.

    11- Сладкий картофель

    Сладкий картофель полон бета-каротина, который ваш организм использует для производства витамина А .Наличие достаточного количества витамина А стимулирует выработку кожного жира железами кожи головы, что предотвращает высыхание волос.

    12- Морковь, тыква, манго и другие апельсиновые овощи

    Оранжевые овощи также содержат бета-каротин , как и сладкий картофель.

    13- Корица

    َََ Добавление небольшого количества корицы в кофе или тосты может иметь большое значение для ускорения роста волос. Корица улучшает кровообращение, а лучшее кровообращение означает, что к волосяным фолликулам поступает дополнительный кислород и питательные вещества.

    14- Яйца

    Яйца богаты биотином, который является витамином B и отвечает за рост волос. Помимо биотина, яйца содержат белков и железа .

    15- Болгарский перец

    Болгарский перец — еще один овощ, содержащий витамина С . Он помогает вашему организму усваивать негемовое железо из других растительных продуктов, таких как бобы и шпинат.

    16- Клубника

    Клубника милая и вкусная, но хорошая новость в том, что она также богата кремнеземом и эллаговой кислотой , которые способствуют росту волос.Все ягоды потенциально могут помочь вам в росте волос.

    17- Папайя

    Папайя помогает иметь сильные волосяные фолликулы, так как в ней содержится аминокислота , коллаген и витамин C . Папайя также может сделать вашу кожу головы здоровой. Присутствующий в нем коллаген помогает восстанавливать поврежденные волосы, что, в свою очередь, способствует их росту.

    18- Авокадо

    Помимо того, что это отличный источник витаминов группы B , минералы, такие как калий, и магний, в масле авокадо, могут запечатать клетки кутикулы, которые помогают волосам выглядеть блестящими и предотвращают ломкость.

    Все питательные вещества в авокадо

    19- Орехи

    Орехи не только вкусные и удобные лакомства, но и содержат широкий спектр витаминов группы B , цинка, и незаменимых жирных кислот , которые помогают волосам становиться сильнее.

    20- Seeds

    Если вы ищете низкокалорийный вариант для получения большого количества питательных веществ, не ищите дальше. Семена богаты витамином Е, , цинком, и селеном , которые способствуют здоровому росту волос.

    Выбирая лучшую пищу для роста волос, вы должны знать, какое питательное вещество вам нужно. Биотин, витамин B12, витамины D, E и C способствуют росту волос. Цинк и железо также входят в число питательных веществ, которые следует учитывать в продуктах для роста и густоты волос.

    Суть в том, что вам необходимо придерживаться сбалансированной диеты, которая не слишком ограничивает рост волос.

    — Для здорового роста волос нужен цинк. Вы можете найти цинк в устрицах, орехах и семенах.

    — Железо необходимо для роста волос, оно содержится в говядине, моллюсках, шпинате и яйцах.

    — Яйца также являются отличным источником биотина.

    — Витамин С содержится в болгарском перце, гуаве, папайе и капусте, и он помогает при возобновлении роста волос.

    — Витамины D, E и A способствуют здоровому росту волос.

    Заявление об ограничении ответственности

    Вы не можете самостоятельно диагностировать причину выпадения волос. Несколько факторов могли вызвать линьку. Их выявление — задача врачей и специалистов, при этом могут потребоваться лабораторные анализы. Использование лекарств от выпадения волос без одобрения врача может вызвать несколько факторов, которые могут нанести вред или взаимодействовать с другими лекарствами, которые вы можете принимать.

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *