
Уреаплазма spp норма у женщин: Ureaplasma species, ДНК количественно [реал-тайм ПЦР]


ДНК уреаплазмы (Ureaplasma species)

10.03.005 — ДНК уреаплазмы (Ureaplasma species)

Описание: Ureaplasma species (spp., уреаплазма специес) — условно-патогенные микроорганизмы, которые являются разновидностью микоплазм, но обладают уреазной активностью — способны расщеплять мочевину до аммиака. Названием Ureaplasma species (Ureaplasma spp.) обозначают два вида микроорганизмов — Ureaplasma urealiticum и Ureaplasma parvum, которые обладают разной степенью патогенности. Их можно отличить только при молекулярно-генетическом исследовании. Уреаплазма уреалитикум (U. urealiticum) ассоциирован с развитием воспалительных заболеваний мочеполовых органов, уреаплазма парвум (U. parvum) с высокой частотой обнаруживается в урогенитальном тракте клинически здоровых женщин. Источник инфекции — больной человек или бактерионоситель. Также возможна передача возбудителя от инфицированной матери плоду во внутриутробном периоде или новорожденному во время родов. Инфицирование Ureaplasma species не всегда приводит к заболеванию, а только при определенных условиях, например при иммунодефицитах, сопутствующих инфекциях, нарушениях местных факторов защиты. Проявления инфекции обычно слабо выражены, она может протекать бессимптомно (чаще у женщин). У мужчин уреаплазмы бывают причиной негонококкового уретрита, цистита, простатита, воспаления яичек (орхита) и их придатков (эпидидимита). В связи со способностью уреаплазм присоединяться к сперматозоидам инфекция также ассоциирована с нарушением состава и качества спермы и с бесплодием. У женщин уреаплазмы могут вызывать воспаление влагалища (вагинит), шейки матки (цервицит). ПЦР современный и очень точный метод диагностики. Высокая чувствительность метода позволяет выявить заболевание на самой ранней стадии. Специфичность определения — 100%. Чувствительность определения — 100 копий ДНК Ureaplasma species.

Рекомендации по времени и условиям сдачи биоматериала: У женщин исследование не проводится во время менструации. Не рекомендуется также проводить исследование во время приема антибактериальных препаратов. Исключить накануне местные лекарственные препараты, половые контакты.

Биоматериал: Соскоб из цервикального канала, соскоб из уретры, соскоб из влагалища, смешанный соскоб из урогенитального тракта, секрет простаты, соскоб с эрозивно-язвенных элементов, мазок с поверхности миндалины, мазок из носоглотки, мазок из ротоглотки, отделяемое конъюнктивы, биоптат легких, биоптат лимфоузлов, биоптат печени, биоптат ЖКТ, бронхо-альвеолярный лаваж, мокрота, моча, амниотическая жидкость, плевральная жидкость, синовиальная жидкость, слюна, спинномозговая жидкость, сперма, другое (указать)

Контейнер для ПП, расходные материалы: эппендорф с транспортной средой и без среды, стерильный контейнер с завинчивающейся крышкой

Инструкция по взятию ПП: Техника взятия биоматериала описана в соответствующих разделах «Инструкции по получению и обработке первичной пробы» Лаборатории «Мобил Медикал Лаб».

Транспортировка, температура и время хранения: общее время хранения и транспортировки при температуре +2…+8°С — не более 24 часов с момента взятия биоматериала

Срок дозаказа (дни): 7 дней

Уреаплазма: симптомы, диагностика и лечение у мужчин и женщин

Автор статьи: КМН, врач уролог-андролог, специалист УЗДСерёженков А. В. Стаж работы: 13 лет

Опубликовано: 05-08-2020

Обновлено: 07-10-2020

До 60-х годов прошлого века болезнями, о которых было стыдно говорить, считались сифилис и гонорея. После сексуальной революции оказалось, что таких неприличных инфекций гораздо больше. Эти инфекции назвали скрытыми, так как они имеют мало проявлений и трудно выявляются. Уреаплазма одна из таких инфекций.

Цены на услуги

Первичный приём уролога ДЛЯ МУЖЧИН + УЗИ предстательной железы (оценка жалоб, сбор анамнеза, при необходимости ректальное пальцевое исследование, узи предстательной железы у мужчин)

Первичный прием – обращение к врачу конкретной специальности в первый раз. Включает беседу с пациентом, первичный осмотр, сбор анамнеза, при необходимости ректальное пальцевое исследование, узи предстательной железы. Цена действительна с 01.02.2021 Цена не действительна на прием в филиалах у м. пр. Большевиков и у м. пр. Просвещения

Записаться на прием

Первичный приём зав. отделением урологии Рыльчиковым И.В. + УЗИ (включает беседу с пациентом, первичный осмотр, сбор анамнеза, при необходимости ректальное пальцевое исследование, узи предстательной железы)

Первичный прием – обращение к врачу конкретной специальности в первый раз.

Записаться на прием

Что такое уреаплазмоз?

Уреаплазмоз — заболевание, вызываемое уреаплазмой (Ureaplasma urealyticum), микроорганизмом по размерам похожим на крупные вирусы и не имеющим ни ДНК, ни клеточной оболочки. Зачастую уреаплазмоз ходит парой с микоплазмозом. Оба эти возбудителя относятся к внутриклеточным микробам и передаются половым путём. Также часто к этой парочке присоединяются другие неприятные возбудители, например, гонорея, трихомониаз или хламидиоз. Эти малютки совсем не безобидны, они подтачивают организм незаметно, но трудолюбиво и упорно.

Симптомы заболевания

Уреаплазмоз протекает бессимптомно. Лишь в периоды обострения возможны слабые прозрачного цвета выделения, возможно жжение и дискомфортные ощущения при мочеиспускании. 

Хроническая форма и осложнения уреаплазмоза

Что плохого может случиться, если не лечить какой-то там уреаплазмоз, от которого ничего не болит, не чешется? Увы, он может стать причиной ряда неприятностей. Хронический уреаплазмоз приводит к воспалительным заболеваниям органов малого таза, к образованию камней мочевого пузыря и почек, к образованию спаек, которое в одних случаях может привести к внематочной беременности, в других — к бесплодию. В отсутствие лечения у мужчин уреаплазмоз может вызывать простатит. Беременные женщины с уреаплазмозом, переносят беременность с осложнениями, у них нередко бывают преждевременные роды.

Скрытые инфекции

В настоящее время трудно найти человека, у которого не было бы тех или иных скрытых инфекций. Причём, чем раньше и активнее начал человек свою сексуальную жизнь, тем гарантированней он станет носителем заразы. Существует даже классификация возрастных групп риска: с 14 до 19 лет (начало половой жизни) и 20-29 лет (расцвет сексуальной активности, поиск спутника жизни).

Отдельно хочется отметить геометрическую прогрессию, с которой скрытые и другие половые инфекции распространяются по миру: каждый заражённый «дарит» партнёру не только свою болячку, но и все те болезни, которые насобирал от предыдущих, а те — от ещё более ранних связей. И так далее. Конечно, так происходит только в случае отказа от барьерной контрацепции — презерватива.

Особенно остро эта проблема стоит среди подростков и молодых людей, которые по последним статистическим данным, становятся распространителями всё большего числа болезней во всё более юном возрасте.

Ещё один путь распространения уреаплазмоза, когда ребёнок получает его от инфицированной матери во время родов, проходя через родовые пути.

Записаться на прием


Как проходит диагностика инфекции? По результатам общего мазка (как у мужчин, так и у женщин) можно лишь предположить наличие уреаплазм. Но в норме уреаплазмы живут в каждом женском организме (у мужчин их не должно быть). Разница лишь в их количестве. У больных уреаплазмозом людей колоний уреаплазмы огромное количество. Поэтому для выявления возбудителя используют более точные методы исследования — метод полимеразной цепной реакции (ПЦР) и бактериальный посев.


Лечение уреаплазмоза назначает только врач, с учётом особенностей биологии возбудителя, его устойчивости к антибиотикам и возможных сопутствующих болезней. В курс лечения входит антибактериальная терапия, физиотерапия, инстилляции. Помимо этого, на время лечения нужно скорректировать образ жизни — отказаться от интимных отношений, соблюдать диету и воздерживаться от алкоголя.


Лучшего метода профилактики упеаплазмоза, чем презерватив никто ещё не придумал. А для поддержания собственного спокойствия можно посоветовать только регулярные профилактические лабораторные обследования.

Важно поставить в известность о своём заболевании прошлых и настоящих партнеров, такой подход говорит об ответственном отношении не только к себе, но и к другим.

Другие статьи автора


Все врачи

Посев на уреаплазмы (Ureaplasma spp.) и определение чувствительности к антимикробным препаратам

Метод определения бактериологический

Исследуемый материал Смотрите в описании

Доступен выезд на дом

Диагностика урогенитальной инфекции, вызванной Ureaplasma spp., и выбор антибиотиков.

Ureaplasma spp. вызывает воспалительный процесс в мочеполовой системе. Этот микроб считают причиной заболевания в том случае, если он обнаружен при лабораторном исследовании, а другие патогенные микроорганизмы, способные вызвать такое воспаление, не выявлены. Уреаплазма передаётся контактно-бытовым, чаще всего — половым путём. Инкубационный период от двух до трёх недель. Инфекция у мужчин проявляется уретритом, ведущим к поражению яичек и придатков, а в конечном итоге к мужскому бесплодию. У женщин этот микроб обнаруживают при бактериальном вагинозе. Бессимптомное течение не снижает риска осложнений. Для выявления возбудителя используют метод бактериального посева. При этом до 80% случаев выявляется совместное инфицирование уреаплазмой, микоплазмой и анаэробной микрофлорой.

Выделяемые возбудители: Ureaplasma spp.

Материал для исследования: в зависимости от показаний у женщин подлежат исследованию мазки из уретры, вагины, шейки матки; у мужчин — мазок из уретры, секрет простаты, эякулят, моча (моча собирается в количестве не менее 40 — 50 мл). Ограничение: у женщин — моча не исследуется.


  1. Богомолов Г.И. Дифференциальная диагностика инфекционных болезней М. 2000. 231 стр.
  2. Гладкова Н.С. и соавт. Оценка различных методов лабораторной диагностики урогенитальных микоплазм.
  3. Вести дерматол. Венерол., 1999, № 2, рр.43 — 45.
  4. Gorbach S. Et al./ Infectious Diseases (3rd edition)/2003/ Lippincott Williams & Wilkins/2700 ps.

симптомы и лечение, причины инфекции, признаки

Что такое уреаплазмоз

Уреаплазмоз — это превышение титра условно-патогенных бактерий — уреаплазм. В норме этот титр не должен превышать 10*4 КОЕ/мл. В микрофлоре здорового человека преобладают лактобактерии, но при дисбиозе могут преобладать гарднереллы, стафилококки и уреаплазмы.

Симптомы заболевания неспецифичны и зависят от пораженного отдела мочеполовой системы. Чаще всего воспаляется мочеиспускательный канал или мочевой пузырь, что проявляется болезненными ощущениями при мочеиспускании и появлением слизистых выделений из уретры. При этом патологический процесс может распространяться и на другие органы. Важная оговорка: уретрит и другие воспалительные заболевания органов малого таза (ВЗОМТ) могут вызывать самые разные бактерии, но уреаплазмоз диагностируют только в том случае, если воспалительные симптомы вызваны именно бактериями Ureaplasma.

Цитата из книги акушера-гинеколога Ольги Белоконь «Я – женщина»

«Уреаплазмы не лечат и не выявляют. Это условные патогены, которые в норме есть у большинства женщин во влагалище. На беременность они не влияют, к выкидышам не приводят, бесплодие не вызывают. Лечить нужно болезни, например бактериальный вагиноз, а также микоплазму гениталиум».

Распространенность заболевания

Уреаплазмоз опасен для женщин в первую очередь развитием уретрита, цервицита, вагинита и ВЗОМТ. Согласно статистике, воспалительные заболевания органов малого таза являются причиной обращения в женскую консультацию в 65% наблюдений. При этом пациентки с ВЗОМТ — это 30% от общего числа проходящих лечение в стационаре. Распространенность сальпингита (воспаление маточных труб) и оофороита (воспаление яичников) по РФ составляет 1236 на 100 000 женщин. 

В США каждый год регистрируют не менее 1 000 000 случаев ВЗОМТ. Этими заболеваниями страдают в основном женщины 17-28 лет, ведущие активную половую жизнь и не прибегающие к барьерным методам контрацепции.


На сегодняшний день микробиологи выделяют 14 видов уреаплазм, однако потенциальную угрозу для человека представляют только Mycoplasma hominis, Ureaplasma urealyticum (T 960) и Ureaplasma parvum. Именно эти виды бактерий способны вызывать воспалительные заболевания уретры и органов малого таза.

Бактерии Mycoplasma hominis. Фото: PHIL CDC

Отдельного упоминания заслуживает Mycoplasma genitalium — этот микроорганизм встречается реже, но обладает высокой патогенностью и устойчивостью ко многим группам антибиотиков. Передается преимущественно половым путем, хотя заражение не исключено и при контакте с кровью больного. Среди микоплазм безусловным возбудителем ЗППП признана только микоплазма гениталиум. Ее обнаружение — диагноз, требующий лечения обоих партнеров.

Уреаплазмы обладают чрезвычайно неприятной особенностью: будучи внутриклеточными паразитами, они проникают в мембраны клеток половых органов, что существенно усложняет борьбу с ними. Дело в том, что при обнаружении активности чужеродных клеток (антигенов) наш организм формирует так называемый иммунный ответ — он вырабатывает антитела, которые уничтожают болезнетворных агентов. Однако если эти агенты надежно укрылись в клетках организма, как это делают уреаплазмы, у антител возникает своего рода когнитивный диссонанс: вроде, клетки свои, хотя и какие-то подозрительные. Атаковать или нет? Обычно антитела выбирают второй вариант, что вполне логично приводит к неэффективности иммунного ответа.

Перечисленные выше виды уреаплазм называют условно-патогенными потому, что они входят в состав естественной микрофлоры мочеполовых путей, и в обычных обстоятельствах никак о себе не напоминают. Однако существуют факторы, благодаря которым уреаплазмы способны создавать своему носителю (то есть человеку) массу неприятностей. Например, если титр уреаплазмы превышает верхнюю границу нормы (она составляет 10*4 КОЕ/мл), может начаться воспалительный процесс на слизистых урогенитального тракта со всеми вытекающими последствиями.

К условным патогенам, которые живут во влагалище здоровых женщин, относятся: 

  • Mycoplasma hominis (микоплазма хоминис),
  • Ureaplasma urealyticum (уреаплазма уреалитикум),
  • Ureaplasma parvum (уреаплазма парвум),
  • влагалищная гарднерелла,
  • кишечная палочка,
  • лептотрикс,
  • стафилококки,
  • стрептококки,
  • энтерококк, клебсиелла.

Их выявление в организме не говорит о болезни. Лечить их следует только в контексте воспалительных заболеваний органов малого таза. 

Способствующие факторы

Развитию воспалительных заболеваний на фоне уреаплазмоза способствуют также дополнительные факторы:

  • ослабление иммунитета,
  • частая смена половых партнеров, ведущая к нарушению микрофлоры половых органов,
  • регулярные стрессы,
  • вредные привычки,
  • беременность,
  • аборт,
  • незащищенный секс,
  • прием гормональных препаратов,
  • наличие венерических заболеваний в анамнезе,
  • спринцевания,
  • использование щелочных средств для интимной гигиены.

Многие женщины особенно уязвимы перед инфекцией в период беременности, так как с наступлением беременности активность значительно иммунитета снижается. 

Пути передачи

Наиболее распространенный способ передачи уреаплазм — половой. Риск заражения существует даже при орально-генитальном контакте. Также возможно инфицирование при родах от матери ребенку — в медицине это называется вертикальным путем передачи инфекции. Бытовой путь передачи специалисты расценивают как маловероятный, поскольку уреаплазмы неустойчивы во внешней среде и вне клеток организма-носителя быстро погибают.

Формы заболевания

Существует две основные формы течения уреаплазмоза:

  1. Острая. Встречается сравнительно редко. При этой форме клиническая картина прослеживается достаточно четко: возникают ярко выраженные симптомы воспаления органов малого таза, которые часто сопровождаются явлениями интоксикации.
  2. Хроническая. Эта форма встречается намного чаще. Симптомы выражены слабо, а зачастую и вовсе отсутствуют. Хроническое течение опасно тем, что болезнь труднее выявить, а запоздалое лечение всегда чревато тяжелыми осложнениями.


В большинстве наблюдений вызванные уреаплазмозом заболевания протекают бессимптомно. Это не дает возможности вовремя начать лечение и приводит к осложнениям. Воспаление на фоне уреаплазмоза у женщин может вызвать следующие последствия:

  • развитие восходящих ВЗОМТ (цервицит — рис. 1, сальпингоофорит),
  • бесплодие — как следствие перечисленных выше заболеваний,
  • прерывание беременности и врожденные патологии у ребенка,
  • сужение уретры как результат разрастания в ее просвете рубцовой ткани (сопровождается ухудшением оттока мочи).
Рисунок 1. Воспаление шейки матки или цервицит — одно из частых заболеваний, ассоциированных с уреаплазмозом. К типичным симптомам цервицита относят белые, сероватые, желтые или кровянистые выделения из влагалища, боль во время секса, тазовые боли, болезненность при мочеиспускании. Источник: Mayo Clinic
Опасность при беременности

Вследствие ВЗОМТ, вызванных повышением титра уреаплазмы, возможны преждевременные роды, замершая беременность и самопроизвольное прерывание беременности. Для ребенка также есть риск возникновения врожденных патологий. 

Что будет, если не лечить

При отсутствии лечения уреаплазмоз может вызвать воспалительные процессы в матке, маточных трубах, яичниках. Образование рубцовой ткани внутри и снаружи маточных труб, в свою очередь, делает их непроходимыми и влечет за собой бесплодие. Недолеченные воспалительные заболевания могут также становиться причиной внематочной беременности и хронических болей в малом тазу и животе. Наконец, любая мочеполовая инфекция увеличивает риск развития рака шейки матки. 

Симптомы у женщин

Симптомы будут зависеть от заболевания, которое вызвал уреаплазмоз. У женщин воспалительные процессы обычно затрагивают влагалище и мочеиспускательный канал. Наиболее распространенные признаки:

  • ощущение зуда или жжения во влагалище,
  • неприятные ощущения в уретре,
  • боль при мочеиспускании,
  • обильные слизистые выделения.
Фото: eddows-animator / freepik.com

При бессимптомном течении все эти проявления будут смазаны, а большинство может отсутствовать вовсе. Однако даже слабо выраженные симптомы должны стать поводом для обращения к врачу. Если этого не сделать вовремя, болезнь может перейти в хроническую форму и вызвать осложнения.

Если не начать лечение вовремя, инфекция поднимается в матку. В этом случае возникают новые симптомы:

  • нарушение менструального цикла,
  • тянущая боль в нижней части живота, которая может усиливаться во время полового акта,
  • в слизистых выделениях появляются примеси крови или гноя,
  • слабость и повышение температуры тела.

Как узнать, нарушена ли микрофлора влагалища

Состояние микробиоценоза влагалища можно оценить с помощью специальных рН-полосок, которые продают в аптеках. Полоску нужно погрузить во влагалищную жидкость, после чего она изменит цвет в зависимости от того, насколько кислой является среда во влагалище (рисунок 2). 

Рисунок 2. Цвет рН-индикатора соответствует показателю уровня рН влагалищной жидкости. Источник: biomedservice.ru

Нормальные показатели рН для влагалищной жидкости: 3,7 — 4,5. Превышение этих значений говорит о наличии дисбиоза, вызванного преобладанием в организме условно-патогенных бактерий. В этом случае стоит обратиться к врачу. Если симптомы присутствуют, а уровень рН влагалища остается нормальным, причиной неприятных ощущений может быть кандида или “молочница”. 


Поводом для начала диагностики уреаплазмоза у женщин могут стать:

  • симптомы уретрита, цистита, вагинита и ВЗОМТ,
  • неудачные попытки забеременеть,
  • преждевременные роды.

Для диагностики применяют следующие методы:

Бактериологический посев (культуральный метод)

Сперва делается мазок из уретры, влагалища или шейки матки. Затем полученные биоматериалы помещают в питательную среду, благоприятную для размножения бактерий, на несколько суток. Метод позволяет определить концентрацию бактерий. Если титр не превышает 10*4 КОЕ/мл, женщина считается носителем уреаплазмы. Если же показатель выше, и при этом есть симптомы воспаления уретры или органов малого таза, назначают медикаментозное лечение. Преимущество бакпосева заключается в возможности проведения тестов на чувствительность уреаплазм к антибиотикам — это существенно облегчит выбор препаратов при лечении.

Полимеразная цепная реакция (ПЦР)

Этот метод определяет наличие чужеродных бактерий по их ДНК. Поскольку у каждого микроорганизма она индивидуальна, то специфичность метода приближается к 100%. Однако у него есть и свои недостатки. Во-первых, такая диагностика обходится довольно дорого; а во-вторых, метод не позволяет точно установить количественный показатель уреаплазм. Это означает, что для контроля лечения он практически бесполезен.


Этот метод также задействует ПЦР, однако позволяет определить и количественный показатель.

Прямая иммунофлюресценция (ПИФ) и иммунофлюоресцентный анализ (ИФА)

Эти методы применяются реже. Главное их преимущество — простота исполнения и низкая себестоимость. Но есть и существенный недостаток — точность редко превышает 70%. Поэтому в настоящее время специалисты почти перестали использовать их в диагностике уреаплазмоза.

Дополнительно назначают следующие исследования:

  • анализ крови (лейкоцитоз),
  • кольпоскопия (очаги воспаления),
  • уретроскопия (слизистая воспалена),
  • УЗИ органов малого таза (очаги воспаления).


При уреаплазмозе лечение направлено на эрадикацию, то есть искоренение возбудителя. Поэтому основу терапевтического курса составляют антибактериальные препараты.


Как мы уже знаем, уреаплазмы склонны к клеточному паразитированию. А это означает, что они проявляют высокую устойчивость не только к антителам, но и к некоторым группам антибиотиков. Пенициллины и цефалоспорины для уреаплазм не представляют угрозы, а потому в лечении не используются. Наименьшую устойчивость эти микроорганизмы проявляют к макролидам и частично — к тетрациклинам. Лучше всего в лечении уреаплазмоза себя зарекомендовали следующие препараты:

  • джозамицин (группа макролидов),
  • азитромицин (группа макролидов),
  • доксициклин (группа тетрациклинов).

Продолжительность курса во многом зависит от выраженности симптомов и результатов лабораторных анализов. В среднем он составляет 10-14 дней.

Важно! Во время курса антибиотиков назначают пробиотики для нормализации баланса кишечной флоры. Средняя продолжительность курса их приема — 1-2 месяца.

Наиболее эффективными в настоящее время считаются следующие препараты:

  • Максилак,
  • Бифиформ,
  • Бактистатин,
  • Бифидумбактерин,
  • Линекс.

Ранее при лечении уреаплазмоза практически повсеместно применялись иммуномодулирующие препараты. Однако с точки зрения доказательной медицины их применение не имеет достаточных оснований. 


Физиотерапевтические методы расцениваются как вспомогательные в контексте базового курса лечения, однако «вспомогательные» не означает «бесполезные». Физиопроцедуры помогают улучшить трофику тканей, дают противовоспалительный, иммуномодулирующий, бактерицидный и обезболивающий эффект. Наиболее распространенные методы:

  1. Озонотерапия — использование насыщенного озоном физраствора.
  2. Магнитотерапия — применение магнитных полей высокой и низкой частоты.
  3. Лазеротерапия — воздействие на паховую зону (именно в случае лечения последствий уреаплазмоза) низкоинтенсивным лазерным излучением.
  4. Электрофорез — воздействие слабого электрического тока позволяет вводить лекарственные средства через кожу и слизистые оболочки.

Особенности лечения при беременности

При лечении беременных женщин наиболее безопасными считаются антибиотики группы макролидов (джозамицин). В первом триместре антибиотики применять не рекомендуется. Всегда важно взвешивать риск для плода и матери.


Фото: freepik.com

Главный способ профилактики уреаплазмоза — использование презервативов при сексуальных контактах с малознакомыми партнерами. Также необходимо проходить плановые осмотры у гинеколога. При появлении даже слабо выраженных симптомов, напоминающих клиническую картину уреаплазмоза, важно не медлить с визитом к врачу. Женщинам следует избегать спринцевания без врачебных показаний.

Важно также позаботиться о поддержании иммунитета. Для этого следует избегать вредных привычек, избегать избыточных физических, интеллектуальных и нервных нагрузок — во всем хороша мера. Чтобы избежать дисбактериоза, не следует самостоятельно применять антибиотики и сульфаниламиды.

Беременным женщинам важно соблюдать правила гигиены. После интимной близости следует проводить санацию половых органов. Целесообразно принимать витамины и придерживаться правил здорового питания.


Отечественные и зарубежные специалисты расходятся во мнениях относительно того, можно ли выделять уреаплазмоз как самостоятельное заболевание. Принято считать, что уреаплазмоз — не столько заболевание, сколько состояние, способное привести к воспалительным процессам в уретре и органах малого таза. Симптомы будут зависеть от того, какой орган вовлечен в патологический процесс.

Для уреаплазмоза характерно бессимптомное течение, что часто приводит к позднему выявлению и развитию таких осложнений, как воспаление яичников, матки и ее придатков. Особую опасность уреаплазмоз представляет для женщины в период беременности: в это время она подвержена повышенному риску инфицирования, при этом в случае развития воспаления не исключены такие осложнения, как замершая беременность и преждевременные роды.

Уреаплазмы передаются преимущественно при незащищенных сексуальных контактах. Не все виды уреаплазм опасны для человека — из 14 выявленных на сегодня биоваров воспалительные процессы могут спровоцировать только Mycoplasma hominis, Ureaplasma urealyticum, Mycoplasma genitalium и Ureaplasma parvum.


  1. Т.Г. Захарова, И.П. Искра // Уреаплазменная инфекция, современные методы диагностики и лечения
  2. А.А. Кубанов, Е.В. Соколовский, М.Р. Рахматулина // Урогенитальные заболевания, вызванные Ureaplasma spp., M. hominis
  3. И.О. Малова, Е.В. Соколовский, М.Р. Рахматулина // Федеральные клинические рекомендации по ведению больных урогенитальными заболеваниями, вызванными Ureaplasma spp., Mycoplasma Hominis

симптомы, причины, диагностика, лечение и профилактика

Уреаплазмоз – это заболевание мочеполовой системы, которое передается половым путем. Заболевание возникает под действием специальной бактерии – уреаплазмы, которая обитает на слизистых оболочках мочеполовых органов. Они находятся в каждом организме и до наступления благоприятных условий не активируются.

Пути попадания активной уреаплазмы в организм могут быть разными:

  • горизонтальные – орально-генитальные и генитальные контакты;
  • вертикальные – от матери к ребенку во время родов.

Причины появления

Причины уреаплазмоза:

  • раннее начало половой жизни;
  • незащищенность полового акта;
  • отсутствие постоянного полового партнера;
  • использование чужих средств личной гигиены;
  • отсутствие личной гигиены;
  • неправильное питание плохого качества;
  • вирусные заболевания;
  • антисанитарные условия проживания;
  • вредные привычки;
  • радиоактивные излучения;
  • прием гормонов и антибиотиков;
  • применение чужого белья.

Пути заражения

Взрослые люди заражаются уреплазмозой только через половые контакты, при этом инкубационный период длится от 7 до 20 дней. В организме с прочной иммунной системой заболевание может годами находится в спящем состоянии. Факторами, способствующими активации вируса, становятся:

  • общее снижение защитной функции организма;
  • обострение хронических болезней;
  • присутствие прочих инфекций;
  • травмирование мочеполовых органов;
  • стрессы и нервные перенагрузки;
  • перепады гормонального фона под действием беременности, аборта или других обстоятельств.

Симптомы и признаки

Симптомы уреаплазмоза у женщин и мужчин различаются, также лечение происходит по-разному. Зачастую симптомы данного заболевания совпадают с прочими заболеваниями мочеполовой системы.

Симптомы у женщин

Уреаплазмоз у женщин имеет следующие признаки:

  • выделения из влагалища в норме не имеют цвета и запаха, а при воспалении становятся желтыми или желто-зелеными;
  • боли внизу живота, имеющие характер рези, свидетельствуют о воспалениях матки или придатков;
  • симптомы ангины – налет на миндалинах, боли в горле говорят об орально-генитальном пути проникновения;
  • боль и дискомфорт во время полового акта во влагалище и сразу после него;
  • боли и жжение во время частых позывов к мочеиспуканию.

Если пропустить начало лечения, то существует высокий риск перехода заболевания в хроническую стадию, когда симптомы и лечение уреаплазмоза становятся серьезнее. На хронической стадии в случае обострения может подниматься температура и появляться признаки интоксикации организма. В результате хронического течения могут образовываться спайки, приводящие к бесплодию. Уреаплазмоз при беременности может повлечь за собой выкидыш, поэтому требует обязательного лечения.

Симптомы у мужчин

Уреаплазмоз у мужчин зачастую протекает без внешних признаков и проявлений. К врачу же обращаются с осложнениями. Крайне редко у мужчин появляется жжение в процессе мочеиспускания и небольшие выделения из уретры.

У вас появились симптомы уреаплазмоза?

Точно диагностировать заболевание может только врач. Не откладывайте консультацию — позвоните по телефону +7 (495) 775-73-60


Среди осложнений также принято выделять женские и мужские, однако обе группы имеют общий признак серьезного поражения органов мочеполовой системы. Заболевание может приводить к циститу, пиелонефриту, нарушениям в ферментативной системе, благодаря которым наблюдается при уреаплазмозе боль в мышцах, может развиваться артрит или поражаются суставы.

Основные осложнения у мужчин:

  • уретрит – дискомфорт во время мочеиспускания, а также боли и рези, жжение в уретре;
  • эпидидимит – воспаление поражает придатки яичка;
  • простатит – приводит к проблемам с эрекцией;
  • бесплодие – ввиду нарушений структуры сперматозоидов.

Основные осложнения у женщин:

  • воспаление на слизистых матки и влагалища – кольпиты, эндометрит и другие;
  • воспаление мышц на матке – миометрит;
  • эрозия шейки матки;
  • возникновение спаек;
  • выкидыш, замирание беременности, преждевременные роды.

Когда следует обратиться к врачу

При наличии первых подозрений на воспалительные процессы в органах мочеполовой системы необходимо обращаться к врачу. Это могут быть гинеколог у женщин, уролог у мужчин или венеролог для всех пациентов.

Многопрофильный медицинский центр АО «Медицина» (клиника академика Ройтберга) предлагает услуги врачей 66 специальностей. Записаться на прием и выбрать доктора можно на сайте, по телефону +7 (495) 775-73-60 или лично посетив клинику по адресу: Москва 2-й Тверской-Ямской переулок д.10. Срочная неотложная помощь требуется при наличии осложнений особенно во время беременности. Вызвать скорую помощь можно из по номеру телефона +7 (495) 229-00-03, к вам на вызов приедут лучшие специалисты.

Диагностика уреаплазмоза

Диагностика проводится следующими методами:

  • молекулярно-биологический – выявляет наличие или отсутствие уреаплазмы в организме без конкретизации его количественного состава;
  • серологический – предполагает обнаружение антител, в основном проводится постфактум для выявления причин тех или иных осложнений;
  • бактериологический – предполагает исследование материала в виде мазка из влагалища или уретры, данный метод позволяет определить наличие, а также качественный и количественный состав уреаплазмы. Именно он имеет значения при выборе схемы лечения уреаплазмоза.

В АО «Медицина» (клиника академика Ройтберга) проводятся любые диагностические исследования. Ознакомиться с перечнем проводимых исследований и их стоимостью можно на сайте.

Наша клиника предлагает современные точные и быстрые методы исследования:

  • ПЦР – молекулярно-биологический метод полимеразной цепной реакции исследует мазок из уретры, дает точный результат о количестве и виде уреаплазмы в течение 5 часов;
  • ИФА – иммуноферментный анализ крови на предмет выработанных антител к вирусной бактерии. Не является самым надежным, так как не определяет количество и структурный состав бактерий, а антитела порой появляются только после выздоровления;
  • РИФ – экспресс-тест на комплексное взаимодействие антиген-антитело под действием флюоресценции.


Как лечить уреаплазмоз? Большинство специалистов придерживается комплексной методики, включающей следующие стадии:

  • антибактериальные препараты при уреаплазмозе могут быть подобраны в качестве комплекса средств – таблетированные формы сочетают со спринцеванием или вагинальными свечами;
  • иммуномодуляторы или зубиотики – для сохранения состава микрофлоры влагалища и желудочно-кишечного тракта;
  • временное воздержание от половых контактов;
  • диетотерапия – исключение из рациона жареного, острого, соленого и алкогольного.

При лечении уреаплазмоза необходимо привлекать к процессу пациента и его сексуальных партнеров. Попутно необходимо пролечить все выявленные инфекционные и вирусные заболевания. По окончании комплексной терапии необходимо первые три-четыре месяца проходить контроль наличия бактерии уреаплазмы и ее состояния.

Терапию делят на острую и хроническую. При острой уреаплазме мышцы могут находиться в тонусе. Основное лечение острой стадии заболевания базируется на приеме антибиотиков, чувствительность к которым выявляется в лабораторных условиях.

Хронические или осложненные формы подразумевают длительный прием антибиотиков, причем одна группа препаратов может сменять другую. В данном случае обязателен прием зубиотиков и иммуномодуляторов для поддержания защитной функции организма и благоприятного состава микрофлоры. В рамках хронической терапии зачастую прибегают к физиопроцедурам – гирудотерапии, электрофорезу и магнитному полю, микроволнам, грязелечению, массажу предстательной железы или гинекологическому массажу, а также другим методам.

Народные рецепты

Среди отваров и настоев из народных рецептов при лечении уреаплазмоза подойдут сборы, повышающие защитные функции организма или укрепляющие иммунитет. Сюда же относят прием в пищу блюд с продуктами богатыми фитонцидами, как средство, направленное на борьбу с ростом вирусных бактерий.

Наиболее популярными народными советами являются:

  • употребление чеснока;
  • отвар или настой в холодном виде из золотарника;
  • настои из смеси трав с использование корня солодки, цветков аптечной ромашки или череды, листьев крапивы и других трав.


Любую болезнь проще предотвратить, чем лечить, тем более такую слабо симптоматическую. К мерам профилактики относят:

  • соблюдение интимной гигиены;
  • избегание случайных половых актов;
  • использование средств контрацепции в процессе полового акта, особенно при оральном или анальном контакте гениталий, так как слизистые горла и кишечника крайне восприимчивы к бактериям;
  • периодически проходить обследование на наличие уреаплазмы.

Лечение уреаплазмоза у женщин требует более тщательного подхода ввиду того, что ее здоровье гарантирует здоровье будущих поколений. В случае случайной половой связи можно провести экстренные меры предупреждения заражения уреаплазмозом – введение в уретру антисептиков местного действия. Данный метод рационально использовать лишь в первые пару часов после полового акта. Кроме того, злоупотребление данным способом влечет неизбежные ожоги слизистой оболочки уретра канала.

как и где сдавать, нормы, расшифровка

Уреаплазмоз — распространенное инфекционное заболевание, которое может повлечь тяжелые последствия при отсутствии своевременного лечения.

Где можно сдать биоматериал на анализ уреаплазмы?

Для того чтобы результаты анализов были максимально достоверными, необходимо правильно подготовиться к их сдаче.

Как подготовиться?

Комфорт — превыше всего. Сдать все необходимые анализы можно не выходя из дома.

Вызвать специалиста на дом…

Спецпредложения, скидки и акции помогут существенно сэкономить на медицинском обследовании.

Посмотреть текущие акции…

Контроль качества лабораторных исследований, осуществляемый по международным стандартам, — дополнительная гарантия точности результатов анализов.

Что учесть при выборе независимой лаборатории?

В мире существует множество вирусов, бактерий и микроорганизмов, которые готовы в прямом и переносном смысле отравить жизнь человека. Одним из очень неприятных диагнозов является уреаплазмоз — патология, вызванная неконтролируемым размножением микроорганизмов уреаплазм. Медицина издавна учится бороться с этими мельчайшими, но опасными врагами, и методы диагностики и лечения уреаплазмоза постоянно совершенствуются.

В нашей статье мы рассмотрим симптомы и способы выявления заболевания, но для начала нужно разобраться — что же представляет собой возбудитель заболевания?

Симптомы уреаплазмоза: когда нужно сдать анализ

Итак, существуют два типа микроорганизмов, вызывающих уреаплазмоз — Ureaplasma urealyticum и Ureaplasma parvum. Согласно статистике не менее 50%, а то и все 70% женщин являются носителями уреаплазмы, но многие об этом даже не подозревают. В обычное время при нормальном иммунитете эти бактерии могут никак себя не проявлять, даже постоянно находясь в организме. Однако при стрессовых нагрузках на организм, при снижении иммунитета патологическое размножение этих микроорганизмов провоцирует воспаление мочеполовой системы, развитие инфекций. Именно в таком случае врач ставит диагноз «уреаплазмоз», нередко сопровождающийся другими. При отсутствии своевременного лечения у мужчин уреаплазмы могут вызвать простатит, бесплодие, эпидидимит, пиелонефрит, у женщин — бесплодие, вагинит, цервицит, эндометрит и т.п. Особую опасность для женщин уреаплазмоз представляет в период беременности. Обусловленное данным состоянием снижение иммунитета приводит к «активизации» микроорганизмов, а вызываемые ими воспалительные процессы могут стать причиной выкидыша или преждевременных родов.

До недавнего времени считалось, что уреаплазменная инфекция — заболевание, передающееся исключительно половым путем. Однако это не так. Основной метод передачи уреаплазмы, действительно, — через незащищенный половой контакт. Период инкубации в этом случае может составлять до полутора месяцев. Симптомы заболевания могут быть не выражены вовсе, но часто наблюдается боль и жжение при мочеиспускании, прозрачные выделения, неприятные ощущения внизу живота. При заражении в ходе орального секса возникают типичные симптомы ангины: боль, белесый налет и покраснения в горле.

Второй возможный путь заражения — от матери к ребенку, внутриутробно или при прохождении малыша через родовые пути. Около 20% младенцев до месяца заражены уреаплазменной инфекцией, однако к полугоду число болеющих снижается до 3–5%.

И наконец, самый малораспространенный, но возможный путь заражения — бытовой. Возбудители инфекции могут быть переданы через предметы личной гигиены, особенно при несоблюдении санитарных норм.

Очень часто появление первичных симптомов уреаплазмоза остается незамеченным, поэтому большинство пациентов проходят анализ на уреаплазму при диагностике причин воспалений того или иного рода. В некоторых случаях бактерии обнаруживают во время обязательных профилактических исследований, назначаемых при беременности или подготовке к зачатию, перед хирургической операцией на половых органах. Однако чтобы своевременно определить наличие инфекции и не допустить ее развития, рекомендуется периодически проходить анализы на уреаплазму в добровольном порядке, особенно при наличии таких факторов риска, как частая смена половых партнеров, уже имеющийся хламидиоз или гонорея, и секс без использования барьерных контрацептивов.

Достоверные методы анализа уреаплазмы

Существует три эффективных метода диагностики уреаплазмоза, каждый из которых обладает своими особенностями:

  • Культуральное исследование
    При проведении такого исследования биоматериал (соскоб или мазок со слизистой влагалища, шейки матки, уретры либо секрет предстательной железы, проба мочи) помещают в комфортные для роста бактерий условия (так называемый посев). Через некоторое время изучают результат, определяя количество вновь появившихся микроорганизмов.

    Анализ имеет ряд достоинств — он позволяет не только диагностировать уреаплазмоз, но и определить чувствительность бактерий к разным видам антибиотиков, благодаря чему подбирают наиболее эффективную лекарственную терапию. Главными недостатками культурального исследования являются продолжительное ожидание результатов (от четырех дней) и не самая высокая точность анализа. Часто причиной искажения данных становятся неправильное взятие мазка или соскоба, а также забор мочи не по правилам.

  • ПЦР
    Полимеразная цепная реакция выявляет ДНК уреаплазмы в исследуемом образце. Для этого из биоматериала выбирают отдельные участки ДНК и в лабораторных условиях «выращивают» их. Полученный образец исследуют с помощью приборов, выявляя признаки наличия ДНК микроорганизмов в клетках.

    ПЦР обеспечивает самые высокие показатели точности (до 98%) и позволяет определить количество бактерий в организме. Еще одним достоинством метода является его скорость — в хорошей лаборатории результаты анализа можно получить уже на следующий день. Минусом анализа можно считать выявление ложноположительных и ложноотрицательных результатов, например, если пациент прошел курс лечения, но еще не все ДНК микроорганизмов выведены из организма.

  • ИФА
    Иммуноферментный анализ — один из серологических методов, позволяет выявить в крови антитела, которые организм вырабатывает при наличии инфекции. Для этого пробу крови помещают на тест-полоску с антигеном уреаплазм. Результат ИФА не всегда однозначно свидетельствует о наличии или отсутствии уреаплазмы, хотя при наличии заболевания ответ чаще всего дается точный — ведь антитела организм вырабатывает для каждого антигена специфические. Проведение повторного анализа через несколько дней или даже недель позволяет судить о динамике заболевания и об участии бактерий в воспалительных процессах. Срок получения результатов — от одного до четырех дней.

Выбрать подходящий метод исследования на уреаплазмоз поможет врач исходя из анамнеза. Очень часто медики рекомендуют комбинировать разные виды анализа для гарантированно точного ответа, например, распространенной практикой является назначения культурального исследования вместе с ПЦР.

Как правильно сдать биоматериал на анализ

Поскольку бактерии Ureaplasma живут на слизистой оболочке половых органов и уретры, обнаружить их чаще всего можно при анализе выделений мочеполовой системы. Так, для выявления уреаплазмоза используют следующие виды биоматериала:

  • у женщин: мазок из шейки матки или вагины, соскоб эпителиальных клеток урогенитального тракта;
  • у мужчин для анализа на уреаплазму берут секрет простаты или сперму;
  • у представителей обоих полов: моча (при посеве — только у мужчин), мазок из уретры.

При анализе на антитела к уреаплазме (ИФА) в качестве биоматериала выступает кровь.

Рекомендации по подготовке к исследованию можно получить при обращении в клинику или лабораторию, проводящую анализ. Обычно ограничения таковы:

  • кровь сдают натощак, после четырех и более часов от последнего приема пищи;
  • мазок и соскоб у женщин не собирают во время менструации. Оптимальный период — с пятого дня до середины цикла, в некоторых случаях допустима вторая половина цикла (например, для посева). Перед взятием материала недопустимо спринцевание;
  • мочу оптимально сдавать из первой утренней порции;
  • мазок из уретры берут, когда с момента мочеиспускания прошло не менее 2–3 часов;
  • любой анализ не рекомендуют проводить в период антибактериальной терапии.

Для лечения уреаплазмоза не существует универсального лекарства — бактерии могут реагировать на один из типов антибиотиков и не реагировать на другой. По этой причине для повышения эффективности терапии дополнительно проводят посев на чувствительность к медикаментам. Очень важно также общее состояние организма пациента: чем активнее он борется с бактериями, тем легче и успешнее пройдет лечение. Поэтому в дополнение к антибиотикам врач обычно назначает препараты для повышения иммунитета.

Расшифровка бланка лабораторного анализа уреаплазмы

Принцип расшифровки результатов анализа на уреаплазмоз схож с другими видами исследований: бланк содержит данные о найденных бактериях (или антителах) в биоматериале, в некоторых случаях — об их количестве. Кроме этого, в бланке указывают нормальные значения. Нормой является отрицательный результат анализов — то есть в данном случае отсутствие уреаплазмы или антител к ней. Если бактерии найдены, для окончательной постановки диагноза следует оценить их количество.

Необходимо помнить, что трактовать результаты анализа и принимать решение о целесообразности лечения может только врач.

  • Культуральное исследование
    Как уже было сказано, посев позволяет выявить не только наличие бактерий в организме, но и их количественные показатели. Если уреаплазма обнаружена, но титр не более 104 КОЕ/мл, пациент считается лишь носителем инфекции. По мнению медиков, при количестве ниже порогового бактерии не наносят вреда организму, поэтому в лечении нет необходимости. Однако при планировании беременности, а также при подготовке к операции на половых органах, терапию назначают, даже если титр уреаплазмы меньше порогового значения.
  • ПЦР
    При обнаружении ДНК уреаплазмы указывают концентрацию копий в пробе. Как и для культурального исследования, общепринятым пороговым значением является 104 КОЕ на 1мл. При показателях ниже, как и в предыдущем случае, лечение чаще всего не назначают.
  • ИФА
    Результат иммуноферментного анализа дает ответ о наличии или отсутствии антител к уреаплазме, а также о соответствии их количества норме. Само по себе присутствие антител не говорит о необходимости лечения — оно может быть вызвано уже перенесенной и вылеченной инфекцией. Если антитела не обнаружены, это может быть признаком не только здорового состояния, но и ранней стадией заражения.

Если количество антител на грани нормы, результат может быть признан сомнительным, и анализ будет назначен повторно через одну–полторы недели, о чем уже упоминалось выше.

Уреаплазмоз — распространенное инфекционное заболевание, которое может иметь тяжелые последствия для организма при отсутствии своевременного лечения. Современные методы диагностики позволяют не только обнаружить бактерии, но и определить их количество, а также подобрать наиболее эффективные препараты для терапии. Но поскольку исследование на уреаплазмы было и остается очень деликатной проблемой, стоит с удвоенным вниманием отнестись к выбору лаборатории для проведения анализа и специфике процедуры в клинике.

Где можно сдать анализ?

Свои комментарии об особенностях проведения исследований дает специалист сети независимых лабораторий «ИНВИТРО»:

«При анализах на выявление уреаплазмоза точность результата зависит от многих факторов. Значительно исказить полученные данные может непрофессиональное взятие биоматериала, а также несоблюдение правил подготовки к исследованию. Поэтому перед обращением в клинику следует внимательно изучить отзывы пациентов, узнать о квалификации сотрудников и конечно, не пренебрегать рекомендациями врачей. Мы в «ИНВИТРО» подробно консультируем пациентов о том, как сдать анализ на уреаплазму.

Разумеется, важную роль играет и метод проведения исследования. Мы считаем ПЦР самым современным и точным способом выявления бактерий в организме. К сожалению, этот тип анализа пока мало представлен в государственных поликлиниках, но в коммерческих медицинских центрах всегда есть возможность сдать материал на исследование. Анализ по методу ПЦР проводят очень быстро: например, в нашей лаборатории анализ занимает всего один день».

P.S. «ИНВИТРО» — бренд, узнаваемый и пользующийся доверием по всей России. В лабораториях «ИНВИТРО» предлагают более сотни видов различных диагностических исследований — лабораторных и инструментальных. В филиалах используется только современное и надежное оборудование, работает квалифицированный и опытный персонал.

Лицензия на осуществление медицинской деятельности № ЛО-50-01-009134 от 26 октября 2017 г.

Уреаплазмоз — симптомы и лечение

Уреаплазмоз – это инфекционное заболевание, вызываемое микроорганизмами Ureaplasma urealyticum, которые передаются половым путём.

Данное заболевание поражает мочеполовую систему, как женщин, так и мужчин. Уреаплазмоз достаточно каверзная болезнь, которая может протекать с периодической симптоматикой, либо с её отсутствием, однако приводит к осложнениям воспалительного характера и не редко к бесплодию.

Поэтому консультация гинеколога или же консультация уролога – это первое, о чём вы должны подумать при малейших подозрениях на уреаплазмоз.

Симптомы уреаплазмоза у мужчин и женщин схожи: жжение и умеренная боль при мочеиспускании, незначительные прозрачные выделения, а также боль внизу живота.

Однако гинекологи и урологи достаточно часто сталкиваются с бессимптомным протеканием уреаплазмоза, по этой причине уреаплазмоз одно из самых распространенных заболеваний передающихся половым путем, так как многие носители, не подозревая о наличии у них уреаплазм, ведут активную половую жизнь без барьерных средств контрацепции.

Поэтому даже если вас ничего не беспокоит, желательно проходить профилактический осмотр гинеколога или уролога раз в полгода.

Своевременное лечение уреаплазмоза может избавить вас от таких неприятных явлений, как уретрит, мочекаменная болезнь, воспалительные заболевания матки и придатков, а главное от проблем во время беременности и возможного бесплодия.

Что касается бесплодия, то уреаплазмы могут вызвать его в равной степени и у женщин, и у мужчин. Уреаплазмоз передаётся и от матери к ребёнку во время беременности или родов, к тому же он может вызвать патологии в развитии плода. Поэтому подготовка к беременности обязательно должна сопровождаться сдачей анализов на уреаплазменную инфекцию и другие ЗППП.

Современные технологии диагностики гинекологических и урологических заболеваний позволяют достаточно быстро выявить уреаплазмоз. В основном применяется ПЦР (метод полимеразной цепной реакции), серологический метод, ИФА и ПИФ.

Целью диагностики является не только выявление уреаплазм, но и проверка их чувствительности к различным антибиотиком, что позволяет назначить более эффективное лечение уреаплазмоза в каждом отдельном случае.

То есть лечение уреаплазмоза должно быть строго индивидуальным, исключающим какое бы то ни было самолечение, так как. при неправильной дозировке и подборе препарата уреаплазмы приспособятся и выработают иммунитет, а это значит, что после подобного «помоги себе сам» процесс квалифицированного лечения затянется и усложнится как минимум в два раза.

Лечение уреаплазмоза

Так как микроорганизм уреаплазма по своим свойствам занимает промежуточное положение между бактериями, вирусами и паразитирующими простейшими, то и лечится уреаплазмоз антибактериальными препаратами.

Как было сказано выше, подбор антибиотиков и их дозировка осуществляются исключительно индивидуально потому, что каждый пациент – это отдельный случай, со своими особенностями, как самого организма, так и уреаплазм.

Обычно антибиотики назначаются для приёма внутрь и местного воздействия (вагинальные свечи или таблетки, инстилляции лекарственных средств в мочеиспускательный канал, массаж предстательной железы и физиотерапия).

Основной принцип в лечении уреаплазмоза, как и любого заболевания передающегося половым путём – это лечение обоих партнёров, с целью исключения возможности повторного инфицирования от больного к здоровому.

У антибиотиков есть один существенный недостаток – они не только убивают патогенные микроорганизмы, но и негативно воздействуют на здоровую микрофлору, при этом ослабляя иммунитет.

Поэтому антибактериальная терапия всегда сопровождается принятием иммуномодулирующих препаратов, которые не только поддержат иммунитет, но и дополнительно к антибиотикам помогут справиться с инфекцией.

В среднем, лечение уреаплазмоза занимает 2 недели и не вызывает особых сложностей и неудобств, кроме того, что необходимо соблюдать диету (минимум жаренного, острого и солёного), исключить алкоголь и отказаться от половой жизни на срок лечения.

После завершения курса лечения необходимо контрольное обследование.

У женщин контрольные анализы берутся перед началом ближайшей менструации и еще раз через месяц. У мужчин первый контрольный анализ проводится через 2 недели после завершения приёма антибиотиков, и также ровно через месяц.

Самые положительные эмоции как у пациента, так и у врача, вызывают отрицательные результаты проведённых анализов, которые означают, что уреаплазма побеждена. Но никто не застрахован от повторного заражения, поэтому не стоит забывать про меры профилактики уреаплазмоза:

  • Постоянный партнёр.
  • Отказ от беспорядочной половой жизни.
  • Использование барьерных средств контрацепции, если вы не уверены в партнёре.
  • Профилактический осмотр гинеколога или врача уролога раз в полгода.

Заведующая гинекологическим отделением
Карапетян Гаяне Артаваздовна

Распространенность и чувствительность к противомикробным препаратам Ureaplasma urealyticum у бессимптомных женщин в Северной Греции

Hippokratia. 2013 октябрь-декабрь; 17 (4): 319–321.

Tz Kotrotsiou

1 Кафедра микробиологии, Медицинский факультет, Университет Аристотеля, Салоники, Салоники, Греция

M Exindari

1 Кафедра микробиологии, Медицинский факультет, Аристотельский университет 9000, Салоники, Салоники 9000, Салоники, Салоники, Салоники 9000 E Diza

1 Кафедра микробиологии, Медицинский факультет, Салоникский университет Аристотеля, Салоники, Греция

G Gioula

1 Кафедра микробиологии, Медицинский факультет, Салоникский университет Аристотеля, Салоники

, Греция 4

1 Отделение микробиологии, Медицинский факультет, Университет Аристотеля в Салониках, Салоники, Греция

K Kaplanis

2 Отделение гинекологии, Больница Theagenion Anticancer в Салониках, Салоники

0007, Греция

Отделение микробиологии, С Медицинская школа, Университет Аристотеля в Салониках, Салоники, Греция

1 Отделение микробиологии, Медицинский факультет, Университет Аристотеля в Салониках, Салоники, Греция

2 Отделение гинекологии, Теагенион Антиканцерская больница, Салоники, Салоники

, Салоники, Салоники, Салоники, Греция Ассистент.Профессор Мария Экзиндари, кафедра микробиологии, медицинский факультет, Университет Аристотеля в Салониках, университетский городок, 54124 Салоники, Греция, тел .: +302310999031, факс: [email protected] другими статьями в PMC.


Цель: Это исследование направлено на определение распространенности и чувствительности к противомикробным препаратам Ureaplasma urealyticum у бессимптомных женщин в Северной Греции.

Материалы-методы: Всего 347 мазков из шейки матки были разделены на 5 групп в зависимости от возраста. Образцы культивировали, выделение Ureaplasma urealyticum было подтверждено обнаружением гена уреазы и определена антимикробная чувствительность изолятов к 9 коммерчески доступным антибиотикам.

Результаты: Пятьдесят шесть (16,13%) образцов были признаны положительными. Женщины старше 60 лет заражались редко. Только 9 (16,07%) изолятов были чувствительны ко всем протестированным антимикробным препаратам.Тринадцать изолятов были устойчивыми и 34 промежуточно устойчивыми к ципрофлоксацину, два устойчивыми и 29 промежуточно устойчивыми к офлоксацину, три промежуточно устойчивыми к макролидам, в то время как все были чувствительны к тетрациклинам.

Выводы: В Северной Греции 16,13% бессимптомных женщин являются носителями Ureaplasma urealyticum в основном в репродуктивном возрасте. Практически не наблюдается устойчивости к макролидам и тетрациклинам, тогда как большинство изолятов обладают устойчивостью или умеренной чувствительностью к хинолонам.

Ключевые слова: Ureaplasma urealyticum , распространенность, женщины, бессимптомная, восприимчивость, Северная Греция


Ureaplasma urealyticum принадлежит к семейству Mycoplasmataceae, самый мелкий среди свободноживущих клеточных микроорганизмов в природа. Бактерия обнаружена в мочеполовой системе многих здоровых людей 1 , 2 , при этом вызванные инфекции могут иметь различные клинические признаки.Помимо возможны симптоматические инфекции, субклинические или простое носительство. В урогенитальная колонизация зависит от пола, возраста, сексуальной активности и гормонального фона. положение дел. Это было связано с низким социально-экономическим уровнем, молодым возрастом, большим количество половых партнеров, афроамериканское происхождение и оральные контрацептивы используйте 3 , 4 . Патогенные эффекты бактерии включают акушерские, перинатальные, урологические и детские инфекции. Взрослые могут урогенитальные инфекции, такие как негоноккокальный уретрит (НГУ), хронический простатит и эпидидимит у мужчин и вагинит и цервицит у женщин 4 6 .

В 2002 г. Ureaplasma urealyticum была разделена на два вида: U. parvum (биотип 1) и U. urealyticum (биотип 2) 7 . U. parvum чаще обнаружено в пробах из влагалища и шейки матки 4 , 6 , 8 10 . Б-лактам антибиотики нельзя использовать для U. urealyticum , так как у них отсутствует структура клеточной стенки. Антибиотики выбора — те, которые влияют на белок. синтез (макролиды и тетрациклины) и до активного состава нуклеиновых кислот (хинолоны) 11 . U. urealyticum Устойчивость к наблюдалась во всем мире ко всем трем категориям антибиотиков, макролидов, тетрациклинов и хинолонов 6 , 12 16 , что вызывает опасения и увеличивает важность наблюдения за уреаплазмой. Подобные результаты были опубликованы в Греция 17 , 18 , хотя устойчивость к U. urealyticum в настоящее время недостаточно изучена.

Таким образом, настоящее исследование исследует распространенность U.urealyticum у бессимптомных женщин в Северной Греции и чувствительности микроорганизма к различным антимикробным агентам.

Материалы и методы

Всего было взято 347 мазков из шейки матки. от бессимптомных женщин, посетивших противораковую больницу Теагенион в Салониках для ежегодного контроля пробы Папаниколау в рамках профилактического скрининга программа.

Отобранные женщины были в возрасте от 20 до 70 лет, жители Северной Греции, без ограничений по расе или национальности, сообщать об отсутствии симптомов со стороны половой системы и антимикробной терапии во время предыдущий месяц по любой причине.Выборки были разделены на 5 возрастных групп. 20-30, 31-40, 41-50, 51-60 и ≥61 лет, в том числе 42, 57, 109, 107 и 32 образца соответственно.

Образцы получены ватным тампоном из переходной зоны шейки матки после удаления избыток выделений из влагалища и шейки матки. Тампон был погружен в специальный среда для хранения и транспортировки микоплазм (Mycoplasma U-A Broth, Биопрепарат, Греция).

Небольшие количества всех бульонов инокулировали на Чашки с агаром A7 (Mycotest Agar, Bioprepare, Греция) и инкубируют в течение 48 часов. в 37 ο C с 10% CO 2 . Ureaplasma изоляция была подтверждено пластинчатой ​​микроскопией.

Положительные результаты получены традиционные методы были подтверждены молекулярными методами. После ДНК экстракции (QIAamp DNA Mini Kit, Qiagen, Hilden, Германия), проводили ПЦР в реальном времени. предназначен для обнаружения гена уреазы (мочевина A, ureB, часть ureC) во всех положительные образцы. Амплифицированный ген уреазы состоит из 429 оснований. Праймеры были используется для обнаружения согласно Бланчарду и др. 19 и Битону и др. 6 .

Штаммы U. urealyticum виды Затем были разделены на U. urealyticum и U. parvum с помощью полимеразной цепной реакции в реальном времени (ПЦР) (Sacace Biotechnologies Srl, Италия) в соответствии с инструкциями производителя.

Фенотипическая устойчивость контроль осуществлялся широко используемым стандартизированным методом, который проверяет чувствительность к 9 антибиотикам в двух концентрациях (Mycoplasma IST 2, Биомерье, Франция).

Метод основан на изменение цвета по мере увеличения pH из-за воздействия микроорганизмов на жидкая питательная среда. Используемые антибиотики: доксициклин, джозамизин, офлоксацин, эритромицин, тетрациклин, ципрофлоксацин, азитромицин, кларитромицин и пристинамицин. Умеренная чувствительность указана, если изменение цвета наблюдается только при самой низкой концентрации антибиотика, тогда как о резистентности сообщается, когда наблюдается изменение как в антибиотиках, так и в антибиотиках. концентрации.

Статистический анализ был выполнен с использованием SPSS 13.0 (SPSS Inc., Чикаго, Иллинойс, США).


Что касается распространенности, U. urealyticum spp был обнаружен в высокой концентрации (> 10 4 ) в 56 (16,1%) из 347 культивированных образцов. Все положительные образцы были подтверждены ПЦР в реальном времени. Далее изоляты были классифицированы по видам: 54 из них принадлежали к U. parvum и 2 — к U. urealyticum .

Из 42 образцов принадлежащих в возрастной группе 20-30 лет 8 (19,0%) были положительными; из 57 образцов в возрастной группе 31-40 лет 12 (21,1%) были положительными; из 109 пробы, относящиеся к возрастной группе 41-50 лет, 21 (19,3%) оказались положительными; из из 107 проб, относящихся к возрастной группе 51-60 лет, 14 (13,1%) оказались положительными; в то время как из 32 выборок, относящихся к возрастной группе ≥61 года, только 1 (3,1%) положительный. Попарное статистическое сравнение среди всех возрастных групп выявлены статистически значимые различия только для лиц старше 61 года. (по сравнению с 20-30 годами р = 0.0379, до 31-40 лет p = 0,0175, до 41-50 лет p = 0,0263 и к сумме p = 0,0488). Все остальные парные комбинации представлены р> 0,05.

Относительно восприимчивости к антибиотикам только 9 (16,07%) из 56 выделенных штаммов были чувствительны к все 9 антибиотиков.

Исследование чувствительности к хинолонам указали, что 13 (23,21%) штаммов были устойчивыми, а 34 (60,07%) — устойчивыми. умеренная чувствительность к ципрофлоксацину, тогда как устойчивость к офлоксацину была наблюдается у 2 (3,5%) штаммов и умеренная чувствительность у 29 (51.79%).

Что касается чувствительности к макролидам, 1 (1,7%) штамм оказался умеренно чувствительным к азитромицину, 1 (1,7%) умеренно чувствительны к кларитромицину и 1 (1,7%) к эритромицину.

Все штаммы были чувствительны к тетрациклинам.

Возрастное распределение женщин с устойчивыми и умеренно чувствительными штаммами показано на.

Таблица 1

Устойчивость выделенных штаммов U. urealyticum к различным хинолонам и макролидам


Настоящее рандомизированное выборка среди клинически здоровой женской популяции N.Греция доказала что 16,13% этих бессимптомных женщин были носителями Ureaplasma urealyticum spp. в высоких концентрациях, как здоровые люди, которые включают микроорганизм в нормальную микрофлору влагалища, и / или как возможные будущие пациенты. Наличие уреаплазмы spp обычно встречается у 40–80% клинически здоровых женщин в США 4 , но только у 8,9% в выборке очень молодых женщин в Норвегии 20 . Более того, недавние исследования по не бессимптомные женщины во всем мире представили различные результаты, такие как 20.1% бесплодных женщин в США 21 , 46,52% женщин с генитальным инфекционные болезни в Китае 22 , 20,8% женщин репродуктивного возраста с вульвовагинитом в Афинах 18 .

Большинство носителей U. urealyticum обнаружено среди женщин репродуктивного возраста, факт что указывает на важную роль гормонального профиля и сексуальной активности в распространенность микроорганизма. Роль гормонального статуса относительно наличие Ureaplasma spp. в женских половых путях уже было задокументировано, так как он был обнаружен во влагалищной флоре у 40% сексуально неактивных, у 67% сексуально активных женщин репродуктивного возраста и у 25% женщины в постменопаузе 23 . Интенсивность сексуальной активности также уже были связаны с присутствием Ureaplasma spp 4 .

Что касается видов, 96,4% положительных образцов относятся к U. parvum и только 3,6% к U. urealyticum , обыкновенной нахождение по международной библиографии.В Австралии различие уреаплазм человека привело к U. parvum 87% по сравнению с U. urealyticum 19% 8 . В Германии обнаружен биовар U. parvum . у 81% обследованных женщин, при этом 6% из них были инфицированы обоими биовары 9 . Аналогичным образом в США изолированные уреаплазмы принадлежали U. parvum и до U. urealyticum в пропорции 80% и 20%. соответственно 6 .

Различия, наблюдаемые на фенотипическая лекарственная устойчивость среди групп противомикробных препаратов, по-видимому, коррелировали с их показателями использования.Хинолоны, постоянно следящие за их повышение использования при большом количестве инфекций, высокий процент резистентности (3,5-60% в зависимости от антибиотика) в отличие от макролидов и тетрациклины, устойчивость к которым оказалась очень низкой или полностью отсутствующий. Тетрациклины, по-видимому, намного более эффективны против U. urealyticum , поскольку все исследованные штаммы чувствительны к ним. В соответствии с нашими результатами, Кечагиа и др. Обнаружили устойчивость к разным категориям антибиотиков. которые прописаны в качестве протокола лечения в Греции, 2008 г., а именно: тетрациклины 0-4.5%, макролиды 6,3-33,3% и хинолоны 18-77,5% 17 . Бака и др. Также сообщили о 1-3% тетрациклинах, 12,2-18,1% макролидах, а 86,1% и 53,7% — ципрофлоксацин и офлоксацин соответственно 18 . Исследования, проведенные в разных странах, показывают, что процент резистентности составляет аналогичные уровни. Выделенные во Франции штаммы оказались устойчивыми к тетрациклинам на 2,2% 16 . В Китае устойчивость к хинолонам увеличилась с 2000 г. и превышает 50%. в то время как устойчивость к эритомицину снижена с 63.От 9% до 20% с 2000 года, что связано с широким использованием хинолонов 14 . Согласно Duffy et al., в США изоляты уреаплазмы показали повышенную устойчивость к все фторхинолоны 13 . Кажется, что злоупотребление хинолоном приводит к устойчивость 14 , в основном за счет мутаций ферментов-мишеней или на всем протяжении измененной проницаемости мембраны микроорганизма 6 . Однако штаммы, выделенные в Великобритании, показали одинаковую и очень низкую (1/61) устойчивость к каждой из трех групп противомикробных препаратов, упомянутых выше 6 .

В заключение, Ureaplasma urealyticum у бессимптомных женщин встречается довольно часто. Его растущая устойчивость к хинолонам вызывает опасения по поводу решения проблемы, но также мотивирует будущие исследования на различных уровнях и в разных направлениях.

Конфликт интересов

Нет финансовых или иных отношений, которые могли бы привести к конфликт интересов по поводу этой работы.


1. Прескотт Л., Харли Дж., Кляйн Д. Микробиология, 6 th ed.Макгроу-Хилл, Нью-Йорк. 2005; 892 [Google Scholar] 2. Мюррей П., Розенталь К., Пфаллер М. Медицинская микробиология, 4 -е изд. Эльзевьер Мосби, Филадельфия, Пенсильвания. 2005; 397 [Google Scholar] 3. Вудс Г.Л., Уокер Д.Х. Хламидийные, риккетсиозные и микоплазменные инфекции. Макферсон Р.А., Пинкус МР. Клиническая диагностика и лечение Генри с помощью лабораторных методов. 21 ст. изд. Saunders Elsevier Inc. 2007: 1010–1015. [Google Scholar] 5. Glass JI, Lefkowitz EJ, Glass JS, Heiner CR, Chen EY, Cassell GH.Полная последовательность возбудителя слизистой оболочки Ureaplasma urealyticum. Природа. 2000. 407: 757–762. [PubMed] [Google Scholar] 6. Битон М.Л., Чалкер В.Дж., Максвелл Н.К., Котеча С., Спиллер ОБ. Параллельное титрование и определение устойчивости к антибиотикам у видов Ureaplasma с выявлением новых точечных мутаций в генах, связанных с устойчивостью. Антимикробные агенты Chemother. 2009; 53: 2020–2027. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7. Конг Ф., Гилберт ГЛ. Постгеномная таксономия уреаплазм человека — тематическое исследование, основанное на нескольких последовательностях генов.Int J Syst Evol Microbiol. 2004; 54: 1815–1821. [PubMed] [Google Scholar] 8. Конг Ф., Ма З., Джеймс Дж., Гордон С., Гилберт Г.Л. Идентификация видов и подтипы Ureaplasma parvum и Ureaplasma urealyticum с использованием анализов на основе ПЦР. J Clin Microbiol. 2000; 38: 1175–1179. [Бесплатная статья PMC] [PubMed] [Google Scholar] 9. Abele-Horn M, Wolff C, Dressel P, Pfaff F, Zimmermann A. Ассоциация биоваров Ureaplasma urealyticum с клиническими результатами для новорожденных, акушерских пациентов и гинекологических пациентов с воспалительными заболеваниями органов малого таза.J Clin Microbiol. 1997; 35: 1199–1202. [Бесплатная статья PMC] [PubMed] [Google Scholar] 10. Перейр С., Метифио М, Казанав С., Реноден Х, Шаррон А., Бебеар С. и др. Характеристика отобранных in vitro мутантов Ureaplasma parvum, устойчивых к макролидам и родственным антибиотикам. Int J Antimicrob Agents. 2007. 29: 207–211. [PubMed] [Google Scholar] 11. Заболевания, передающиеся половым путем, Руководство по лечению 2006 г., Заболевания, характеризующиеся уретритом и цервицитом. CDC, Центры по контролю и профилактике заболеваний.доступно по адресу: www.cdc.gov/std/treatment/2006/urethritis-and-cervicitis.htm, по состоянию на 26 января 2010 г. [Google Scholar] 12. Bébéar CM, Renaudin H, Charron A, Clerc M, Pereyre S, Bébéar C. Мутации ДНК-гиразы и топоизомеразы IV в клинических изолятах Ureaplasma spp. и Mycoplasma hominis, резистентная к фторхинолонам. Антимикробные агенты Chemother. 2003. 47: 3323–3325. [Бесплатная статья PMC] [PubMed] [Google Scholar] 13. Даффи Л., Гласс Дж., Холл Г., Эйвери Р., Ракли Р., Петерсон С. и др. Устойчивость к фторхинолонам у Ureaplasma parvum в США.J Clin Microbiol. 2006; 44: 1590–1591. [Бесплатная статья PMC] [PubMed] [Google Scholar] 14. Xie X, Zhang J. Тенденции в скорости устойчивости Ureaplasma urealyticum к антибиотикам и идентификация сайта мутации в области, определяющей устойчивость к хинолонам, у китайских пациентов. FEMS Microbiol Lett. 2006. 259: 181–186. [PubMed] [Google Scholar] 15. Dongya M, Wencheng X, Xiaobo M, Lu W. Переходные мутации в 23S рРНК объясняют приобретенную устойчивость к макролидам у Ureaplasma urealyticum. Microb Drug Resist.2008. 14: 183–186. [PubMed] [Google Scholar] 16. Дегранж С., Реноден Н, Шаррон А, Бебеар С., Бебеар С.М. Устойчивость к тетрациклину у Ureaplasma spp. и Mycoplasma hominis: распространенность в Бордо, Франция, с 1999 по 2002 год и описание двух tet (M) -положительных изолятов M. hominis, чувствительных к тетрациклинам. Антимикробные агенты Chemother. 2008; 52: 742–744. [Бесплатная статья PMC] [PubMed] [Google Scholar] 17. Kechagia N, Bersimis S, Chatzipanagiotou S. Заболеваемость и чувствительность к противомикробным препаратам генитальных микоплазм у амбулаторных женщин с клиническим вагинитом в Афинах, Греция.J Antimicrob Chemother. 2008. 62: 122–125. [PubMed] [Google Scholar] 18. Бака С., Цирмпа И., Цума И., Логотетис Е., Кускуни Э. Повышение устойчивости к хинолонам Ureaplasma urealyticum и Mycoplasma hominis у женщин репродуктивного возраста с вульвовагинитом. 22 nd Европейский конгресс клинической микробиологии и инфекционных заболеваний (ECCMID) 2012, Лондон [Google Scholar] 19. Blanchard A, Hentschel J, Duffy L, Baldus K, Cassell GH. Обнаружение Ureaplasma urealyticum с помощью полимеразной цепной реакции в урогенитальном тракте взрослых, в околоплодных водах и дыхательных путях новорожденных.Clin Infect Dis. 1993; 17 Приложение 1: S148 – S153. [PubMed] [Google Scholar] 20. Jensen AJ, Kleveland CR, Moghaddam A, Haaheim H, Hjelmevoll SO, Skogen V. Chlamydia trachomatis, Mycoplasma genitalium и Ureaplasma urealyticum среди студентов в северной Норвегии. J Eur Acad Dermatol Venereol. 2013; 27: 91–96. [PubMed] [Google Scholar] 21. Имудиа А.Н., Детти Л., Пушек Е.Е., Елиан Ф.Д., Даймонд МП. Распространенность инфекций ureaplasma urealyticum, Mycoplasma hominis, chlamydia trachomatis и neisseria gonorrhoeae, а также статус краснухи у пациентов, проходящих первичную оценку бесплодия.J Assist Reprod Genet. 2008; 25: 43–46. [Бесплатная статья PMC] [PubMed] [Google Scholar] 22. Чжу Ц., Лю Дж., Лин И, Дун Ц., Ву Т, Ю X и др. Распространенность и чувствительность к противомикробным препаратам Ureaplasma urealyticum и Mycoplasma hominis у китайских женщин с инфекционными заболеваниями половых органов. Индийский J Dermatol Venereol Leprol. 2012; 78: 406–407. [PubMed] [Google Scholar]

Результаты большого поперечного исследования по оценке Chlamydia trachomatis, Ureaplasma spp. и урогенитальные инфекции Mycoplasma hominis у пациентов с первичным бесплодием

  • 1.

    Gimenes, F. et al. Мужское бесплодие: проблема общественного здравоохранения, вызываемая патогенами, передающимися половым путем. Нат. Преподобный Урол. 11 , 672–687. https://doi.org/10.1038/nrurol.2014.285 (2014).

    Артикул PubMed Google ученый

  • 2.

    Vander Borght, M. & Wyns, C. Фертильность и бесплодие: определение и эпидемиология. Clin. Biochem. 62 , 2–10. https: // doi.org / 10.1016 / j.clinbiochem.2018.03.012 (2018).

    Артикул Google ученый

  • 3.

    Харт Р. Дж. Физиологические аспекты женской фертильности: роль окружающей среды, современный образ жизни и генетика. Physiol. Ред. 96 , 873–909. https://doi.org/10.1152/physrev.00023.2015 (2016).

    CAS Статья PubMed Google ученый

  • 4.

    Schjenken, J.Э. и Робертсон С. А. Женская реакция на семенную жидкость. Physiol. Ред. 100 , 1077–1117. https://doi.org/10.1152/physrev.00013.2018 (2020).

    Артикул PubMed Google ученый

  • 5.

    Tang, W. et al. Беременность и неблагоприятные исходы, связанные с фертильностью, связанные с инфекцией Chlamydia trachomatis : глобальный систематический обзор и метаанализ. Секс Трансм.Заразить. https://doi.org/10.1136/sextrans-2019-053999 (2019).

    Артикул PubMed Google ученый

  • 6.

    Brunham, R.C. & Rappuoli, R. Контроль Chlamydia trachomatis требует вакцины. Вакцина 31 , 1892–1897. https://doi.org/10.1016/j.vaccine.2013.01.024 (2013).

    CAS Статья PubMed PubMed Central Google ученый

  • 7.

    Паавонен, Дж. Chlamydia trachomatis Инфекции женских половых путей: современное состояние. Ann. Med. 44 , 18–28. https://doi.org/10.3109/07853890.2010.546365 (2012).

    CAS Статья PubMed Google ученый

  • 8.

    Mackern-Oberti, J. P. et al. Chlamydia trachomatis Инфекция мужских половых путей: обновление. J. Reprod. Иммунол. 100 , 37–53.https://doi.org/10.1016/j.jri.2013.05.002 (2013).

    Артикул PubMed Google ученый

  • 9.

    Фарсимадан М. и Мотамедифар М. Бактериальная инфекция мужской репродуктивной системы, вызывающая бесплодие. J. Reprod. Иммунол. 142 , 103183. https://doi.org/10.1016/j.jri.2020.103183 (2020).

    CAS Статья PubMed Google ученый

  • 10.

    Битон, М. Л., Пейн, М. С. и Джонс, Л. Роль Ureaplasma spp. в развитии негонококкового уретрита и бесплодия у мужчин. Clin. Microbiol. Ред. https://doi.org/10.1128/CMR.00137-18 (2019).

    Артикул PubMed PubMed Central Google ученый

  • 11.

    Стоянов, М., Бод, Д., Греб, Г., Вуллиемоз, Н. Мужское бесплодие: внутриклеточная бактериальная гипотеза. New Microbes New Infect. 26 , 37–41. https://doi.org/10.1016/j.nmni.2018.08.012 (2018).

    CAS Статья PubMed PubMed Central Google ученый

  • 12.

    Тейлор-Робинсон, Д. и Дженсен, Дж. С. Mycoplasma genitalium : От куколки до разноцветной бабочки. Clin. Microbiol. Ред. 24 , 498–514. https://doi.org/10.1128/CMR.00006-11 (2011).

    Артикул PubMed PubMed Central Google ученый

  • 13.

    Capoccia, R., Greub, G. & Baud, D. Ureaplasma urealyticum , Mycoplasma hominis и неблагоприятные исходы беременности. Curr. Opin. Заразить. Дис. 26 , 231–240. https://doi.org/10.1097/QCO.0b013e328360db58 (2013).

    Артикул PubMed Google ученый

  • 14.

    Volgmann, T., Ohlinger, R. & Panzig, B. Ureaplasma urealyticum — безвредный комменсал или недооцененный враг репродукции человека? Обзор. Arch. Гинеколь. Акушерство. 273 , 133–139. https://doi.org/10.1007/s00404-005-0030-1 (2005).

    Артикул PubMed Google ученый

  • 15.

    Keane, FE, Thomas, BJ, Gilroy, CB, Renton, A. и Taylor-Robinson, D. Ассоциация Mycoplasma hominis , Ureaplasma urealyticum и Mycoplasma genitalium : бактериальный вагиноз: Наблюдения за гетеросексуальными женщинами и их партнерами-мужчинами. Внутр. J. ЗППП, СПИД 11 , 356–360. https://doi.org/10.1258/09564620016 (2000).

    CAS Статья PubMed Google ученый

  • 16.

    Манхарт, Л. Э., Холмс, К. К., Хьюз, Дж. П., Хьюстон, Л. С. и Тоттен, П. А. Mycoplasma genitalium среди молодых людей в Соединенных Штатах: возникающая инфекция, передаваемая половым путем. Am. J. Общественное здравоохранение 97 , 1118–1125.https://doi.org/10.2105/AJPH.2005.074062 (2007).

    Артикул PubMed PubMed Central Google ученый

  • 17.

    Huang, C. et al. Ureaplasma urealyticum и Mycoplasma hominis инфекции и качество спермы у 19 098 бесплодных мужчин в Китае. Мир J. Urol. 34 , 1039–1044. https://doi.org/10.1007/s00345-015-1724-z (2016).

    ADS Статья PubMed Google ученый

  • 18.

    Ахмади, М. Х., Мирсалехиан, А., Садыги Гилани, М. А., Бахадор, А. и Талеби, М. Бессимптомная инфекция, вызванная Mycoplasma hominis , отрицательно влияет на параметры спермы и приводит к мужскому бесплодию, что подтверждается улучшенными параметрами спермы после лечения антибиотиками. Урология 100 , 97–102. https://doi.org/10.1016/j.urology.2016.11.018 (2017).

    Артикул PubMed Google ученый

  • 19.

    Тейлор-Робинсон, Д., Дженсен, Дж. С., Свенструп, Х. и Стейси, К. М. Трудности, возникшие при определении микробной причины воспалительного заболевания органов малого таза. Внутр. J. ЗППП, СПИД 23 , 18–24. https://doi.org/10.1258/ijsa.2011.011066 (2012).

    CAS Статья PubMed Google ученый

  • 20.

    Тейлор-Робинсон, Д. Инфекции, вызываемые видами Mycoplasma и Ureaplasma: обновление. Clin.Заразить. Дис. 23 , 671–682. https://doi.org/10.1093/clinids/23.4.671 (1996).

    CAS Статья PubMed Google ученый

  • 21.

    Kwak, DW, Hwang, HS, Kwon, JY, Park, YW & Kim, YH Коинфекция вагинальной Ureaplasma urealyticum и Mycoplasma hominis увеличивает неблагоприятные исходы беременности у пациенток с преждевременными родами или преждевременными родами. преждевременный разрыв плодных оболочек. J. Matern. Фетальный. Неонатальный. Med. 27 , 333–337. https://doi.org/10.3109/14767058.2013.818124 (2014).

    Артикул PubMed Google ученый

  • 22.

    Farahani, L. et al. Микробиом спермы и его влияние на функцию спермы и мужскую фертильность: систематический обзор и метаанализ. Андрология https://doi.org/10.1111/andr.12886 (2020).

    Артикул PubMed Google ученый

  • 23.

    Крун, С. Дж., Равель, Дж. И Хьюстон, В. М. Цервиковагинальная микробиота, здоровье женщин и репродуктивные результаты. Fertil. Стерил. 110 , 327–336. https://doi.org/10.1016/j.fertnstert.2018.06.036 (2018).

    Артикул PubMed Google ученый

  • 24.

    Цеват, Д. Г., Визенфельд, Х. К., Паркс, К. и Пайпер, Дж. Ф. Заболевания, передающиеся половым путем, и бесплодие. Am. J. Obstet. Гинеколь. 216 , 1–9.https://doi.org/10.1016/j.ajog.2016.08.008 (2017).

    Артикул PubMed PubMed Central Google ученый

  • 25.

    Редгроув, К. А. и Маклафлин, Е. А. Роль иммунного ответа в Chlamydia trachomatis инфекции мужских половых путей: палка о двух концах. Фронт. Иммунол. 5 , 534. https://doi.org/10.3389/fimmu.2014.00534 (2014).

    CAS Статья PubMed PubMed Central Google ученый

  • 26.

    Tang, W. et al. Беременность и неблагоприятные исходы, связанные с фертильностью, связанные с инфекцией Chlamydia trachomatis : глобальный систематический обзор и метаанализ. Секс Трансм. Заразить. 96 , 322–329. https://doi.org/10.1136/sextrans-2019-053999 (2020).

    Артикул PubMed Google ученый

  • 27.

    Moridi, K. et al. Эпидемиология половых инфекций, вызванных Mycoplasma hominis , M.genitalium и Ureaplasma urealyticum в Иране; систематический обзор и метааналитическое исследование (2000–2019 гг.). BMC Public Health 20 , 1020. https://doi.org/10.1186/s12889-020-08962-5 (2020).

    Артикул PubMed PubMed Central Google ученый

  • 28.

    Piscopo, R.C. et al. Повышенная распространенность колонизации эндоцервикальной микоплазмы и уреаплазмы у бесплодных женщин с трубным фактором. JBRA Assist. Репродукция. 24 , 152–157. https://doi.org/10.5935/1518-0557.201


    Артикул PubMed PubMed Central Google ученый

  • 29.

    Тантенгко, О.А.Г., де Кастро Силва, М. и Велайо, С.Л. Роль генитальной микоплазмы в женском бесплодии: систематический обзор и метаанализ. Am. J. Reprod. Иммунол. https://doi.org/10.1111/aji.13390 (2021 г.).

    Артикул PubMed Google ученый

  • 30.

    Aung, E. T. et al. Международные поездки как фактор риска для Chlamydia trachomatis инфекций среди молодых гетеросексуалов, посещающих клинику сексуального здоровья в Мельбурне, Австралия, с 2007 по 2017 год. евро Surveill. https://doi.org/10.2807/1560-7917.ES.2019.24.44.1

    9 (2019).

    Артикул PubMed PubMed Central Google ученый

  • 31.

    CDC. Эпиднадзор за заболеваниями, передаваемыми половым путем, 2018 (CDC, 2019).

    Google ученый

  • 32.

    Chen, H. et al. Chlamydia trachomatis и инфекция вируса папилломы человека у женщин из южной провинции Хунань в Китае: крупное обсервационное исследование. Фронт. Microbiol. 11 , 827. https://doi.org/10.3389/fmicb.2020.00827 (2020).

    Артикул PubMed PubMed Central Google ученый

  • 33.

    Абусара, Э. А., Аввад, З. М., Чарвалос, Э. и Шехаби, А. А. Молекулярное обнаружение потенциальных возбудителей, передающихся половым путем, в образцах спермы и мочи бесплодных и фертильных мужчин. Диагн. Microbiol. Заразить. Дис. 77 , 283–286. https://doi.org/10.1016/j.diagmicrobio.2013.05.018 (2013).

    Артикул PubMed Google ученый

  • 34.

    Sleha, R. et al. Распространенность Mycoplasma hominis и Ureaplasma urealyticum у женщин, проходящих первичную оценку бесплодия. Epidemiol. Микробиол. Имунол. 65 , 232–237 (2016).

    CAS PubMed Google ученый

  • 35.

    Gdoura, R. et al. Оценка Chlamydia trachomatis , Ureaplasma urealyticum , Ureaplasma parvum , Mycoplasma hominis и Mycoplasma genitalium в образцах спермы партнеров мужского пола в качестве бесплодной мочи. Дж. Андрол. 29 , 198–206. https://doi.org/10.2164/jandrol.107.003566 (2008).

    CAS Статья PubMed Google ученый

  • 36.

    Song, T., Liu, Z., Zhang, Y., Han, Y. & Huang, J. Обнаружение Ureaplasma spp. серовары в половых путях бесплодных мужчин. J. Clin. Лаборатория. Анальный. 33 , e22865. https://doi.org/10.1002/jcla.22865 (2019).

    Артикул PubMed PubMed Central Google ученый

  • 37.

    Moretti, E. et al. Наличие видов бактерий в сперме и качестве спермы. J. Assist. Репродукция. Genet. 26 , 47–56. https://doi.org/10.1007/s10815-008-9283-5 (2009).

    Артикул PubMed Google ученый

  • 38.

    Boeri, L. et al. Инфекции спермы у мужчин с первичным бесплодием в реальных условиях. Fertil. Стерил. 113 , 1174–1182.https://doi.org/10.1016/j.fertnstert.2020.01.034 (2020).

    CAS Статья PubMed Google ученый

  • 39.

    Veiga, E. et al. Распространенность генитальной микоплазмы и ответ на лечение эрадикацией у пациентов, подвергающихся вспомогательным репродуктивным методам. Rev. Esp. Quimioter. 32 , 327–332 (2019).

    CAS PubMed PubMed Central Google ученый

  • 40.

    Imudia, AN, Detti, L., Puscheck, EE, Yelian, FD & Diamond, MP Распространенность Ureaplasma urealyticum , Mycoplasma hominis , Chlamydia trachomatis и инфекций Nerhoeella gonoria пациенты, проходящие первичную оценку бесплодия. J. Assist. Репродукция. Genet. 25 , 43–46. https://doi.org/10.1007/s10815-007-9192-z (2008).

    Артикул PubMed PubMed Central Google ученый

  • 41.

    Lee, J. Y. & Yang, J. S. Распространенность и чувствительность к противомикробным препаратам видов Mycoplasma hominis и Ureaplasma у небеременных пациенток в Южной Корее указывает на тенденцию к увеличению числа изолятов, устойчивых к пристинамицину. Антимикробный. Агенты Chemother. https://doi.org/10.1128/AAC.01065-20 (2020).

    Артикул PubMed PubMed Central Google ученый

  • 42.

    Ли, М.Ю., Ким, М. Х., Ли, В. И., Кан, С. Ю. и Чон, Ю. Л. Распространенность и чувствительность к антибиотикам Mycoplasma hominis и Ureaplasma urealyticum у беременных женщин. Yonsei Med. J. 57 , 1271–1275. https://doi.org/10.3349/ymj.2016.57.5.1271 (2016).

    Артикул PubMed PubMed Central Google ученый

  • 43.

    Buzo, B. F. et al. Связь между микоплазмой и уреаплазмой в дыхательных путях, уровнем аммиака и исходами после трансплантации легких: проспективное контрольное исследование. Am. J. Transplant https://doi.org/10.1111/ajt.16394 (2020).

    Артикул PubMed Google ученый

  • 44.

    ВОЗ. Веб-глава Всемирной организации здравоохранения о бесплодии у пар. URL: http://www.who.int/reproductivehealth/topics/infertility/definitions.

  • 45.

    Frolund, M. et al. Патогены, ассоциированные с уретритом, в моче мужчин с негонококковым уретритом: исследование случай-контроль. Acta Derm. Венереол. 96 , 689–694. https://doi.org/10.2340/00015555-2314 (2016).

    CAS Статья PubMed Google ученый

  • 46.

    Shimada, Y. et al. Бактериальные нагрузки Ureaplasma urealyticum способствуют развитию уретрита у мужчин. Внутр. J. ЗППП, СПИД 25 , 294–298. https://doi.org/10.1177/0956462413504556 (2014).

    CAS Статья PubMed Google ученый

  • 47.

    Deguchi, T. et al. Бактериальная нагрузка Ureaplasma parvum способствует развитию воспалительных реакций в мужской уретре. Внутр. J. ЗППП, СПИД 26 , 1035–1039. https://doi.org/10.1177/0956462414565796 (2015).

    Артикул PubMed Google ученый

  • Частота Chlamydia trachomatis у уреаплазмопозитивных здоровых женщин, впервые посещающих дородовой госпиталь в Саппоро, Япония | BMC Инфекционные болезни

  • 1.

    ВОЗ: Глобальная распространенность и заболеваемость излечимыми Stis. 2001, Женева: Всемирная организация здравоохранения

    Google ученый

  • 2.

    ВОЗ: приоритетные глазные болезни. 2008, [документ WWW]. URL http://www.who.int/blindness/causes/priority/en/index2.html

    Google ученый

  • 3.

    Хорнер П: Случай для дальнейших исследований лечения неосложненной генитальной инфекции Chlamydia trachomatis .Половая трансмиссия. 2006, 82: 340-343. 10.1136 / sti.2005.019158.

    CAS Статья PubMed PubMed Central Google ученый

  • 4.

    Галлегос Г., Рамос Б., Сантисо Р., Гоянес В., Госальвес Дж, Фернандес Дж. Л.: Фрагментация ДНК сперматозоидов у бесплодных мужчин с мочеполовой инфекцией, вызванная Chlamydia trachomatis и Mycoplasma . Fertil Steril. 2008, 90: 328-334. 10.1016 / j.fertnstert.2007.06.035.

    Артикул PubMed Google ученый

  • 5.

    Bezold G, Politch JA, Kiviat NB, Kuypersm JM, Wolff H, Anderson DJ: Распространенность возбудителей, передающихся половым путем, в сперме от бессимптомных пациентов с мужским бесплодием с лейкоцитоспермией и без нее. Fertil Steril. 2007, 87: 1087-1097. 10.1016 / j.fertnstert.2006.08.109.

    Артикул PubMed PubMed Central Google ученый

  • 6.

    Якиэль Г., Робак-Чолюбек Д., Вичорек П., Бокинец М.: Оценка некоторых параметров спермы человека с положительной хламидийной реакцией.Ann Univ Mariae Curie Sklodowska. 2004, 59: 61-64.

    Google ученый

  • 7.

    Gdoura R, Keskes-Ammar L, Bouzid F, Eb F, Hammami A, Orfila J: Chlamydia trachomatis и мужское бесплодие в Тунисе. Eur J Contracept Reprod Health Care. 2001, 6: 102-107.

    CAS Статья PubMed Google ученый

  • 8.

    Custo GM, Lauro V, Saitto C, Frongillo RF: Хламидийная инфекция и мужское бесплодие: эпидемиологическое исследование.Арка Андрол. 1989, 23: 243-248. 10.3109 / 01485018


    CAS Статья PubMed Google ученый

  • 9.

    Гамп Д., Гибсон М., Ашикага Т.: Доказательства предшествующего воспалительного заболевания органов малого таза и его связь с Chlamydia trachomatis антителом и использованием внутриматочных противозачаточных средств у бесплодных женщин. Am J Obstet Gynecol. 1983, 146: 153-159.

    CAS Статья PubMed Google ученый

  • 10.

    Ласк М.Дж., Конечны П: Цервицит: обзор. Curr Opin Infect Dis. 2008, 21: 49-55.

    PubMed Google ученый

  • 11.

    Marrazzo JM: Слизисто-гнойный цервицит: больше не игнорируется, но все еще неправильно понимается. Заражение Dis Clin N America. 2005, 19: 333-349. 10.1016 / j.idc.2005.03.009.

    Артикул Google ученый

  • 12.

    Debattista J, Gazzard CM, Wood RN, Allan JA, Allan JM, Scarman A, Mortlock M, Timms P, Knox CL: Взаимодействие микробиологии и патологии у женщин, проходящих обследование на бесплодие.Заражение Dis Obstet Gynecol. 2004, 12: 135-145. 10.1080 / 10647440400020703.

    Артикул PubMed PubMed Central Google ученый

  • 13.

    Конг Ф., Ма З., Джеймс Дж., Гордон С., Гилберт Г.Л.: Идентификация видов и выделение подтипов Ureaplasma parvum и Ureaplasma urealyticum с использованием анализов на основе ПЦР. J Clin Microbiol. 2000, 38: 1175-1179.

    CAS PubMed PubMed Central Google ученый

  • 14.

    Kong F, James G, Ma Z, Gordon S, Wang B, Gilbert GL: Филогенетический анализ Ureaplasma urealyticum — поддержка создания нового вида, Ureaplasma parvum. Int J Syst Bacteriol. 1999, 49: 1879-1889. 10.1099 / 00207713-49-4-1879.

    CAS Статья PubMed Google ученый

  • 15.

    Kong F, Zhu X, Wang W, Zhou X, Gordon S, Gilbert GL: Сравнительный анализ и серовар-специфическая идентификация многополосных антигенных генов биовара Ureaplasma urealyticum 1.J Clin Microbiol. 1999, 37: 538-543.

    CAS PubMed PubMed Central Google ученый

  • 16.

    Abele-Horn M, Wolff C, Dressel P, Pfaff F, Zimmermann A: Ассоциация биоваров Ureaplasma urealyticum с клиническим исходом для новорожденных, акушерских пациентов и гинекологических пациентов с воспалительными заболеваниями органов малого таза. J Clin Microbiol. 1997, 35: 1199-1202.

    CAS PubMed PubMed Central Google ученый

  • 17.

    Тейлор-Робинсон Д., Ферр П.М.: Инфекции генитальной микоплазмы. Wien Klin Wochenschr. 1997, 109: 578-583.

    CAS PubMed Google ученый

  • 18.

    Олликайнен Дж., Хейсканен-Косма Т., Корппи М., Катила М.Л., Хейнонен К. Клиническая значимость колонизации Ureaplasma urealyticum у недоношенных детей. Acta Paediatr. 1998, 87: 1075-1078. 10.1111 / j.1651-2227.1998.tb01417.x.

    CAS Статья PubMed Google ученый

  • 19.

    Талли Дж. Г.: Текущее состояние молликутовой флоры человека. Clin Infect Dis. 1993, 17 (Приложение 1): S2-S9.

    Артикул PubMed Google ученый

  • 20.

    Чжэн X, Уотсон Х.Л., Уэйтс К.Б., Касселл Г.Х.: Разнообразие серотипов и вариация антигенов среди инвазивных изолятов Ureaplasma urealyticum от новорожденных. Заражение иммунной. 1992, 60: 3472-3474.

    CAS PubMed PubMed Central Google ученый

  • 21.

    Кобаяси М., Исида К., Мацуо Дж., Накамура С., Нагасава А., Мотохаши К., Яо Т., Хираи И., Ямамото И., Сузуки Х., Симидзу С., Мацуно К., Ямагути Н.: Chlamydophila pneumoniae при прикреплении и инфекции экспрессирующие лимфоидные клетки Jurkat человека. Microb Pathog. 2011, 51: 209-216. 10.1016 / j.micpath.2011.03.010.

    CAS Статья PubMed Google ученый

  • 22.

    Эдгар RC: МЫШЦЫ: множественное выравнивание последовательностей с высокой точностью и высокой пропускной способностью.Nucleic Acids Res. 2004, 32: 1792-1797. 10.1093 / нар / гх440.

    CAS Статья PubMed PubMed Central Google ученый

  • 23.

    Mahony JB, Jang D, Chong S, Luinstra K, Sellors J, Tyndall M, Chernesky M: обнаружение Chlamydia trachomatis, Neisseria gonorrhoeae, Ureaplasma urealyticum и Mycoplasma urealyticum first-uritalas , и Mycoplasma genitalium образцы методом мультиплексной полимеразной цепной реакции. Mol Diagn.1997, 2: 161-168. 10.1016 / С1084-8592 (97) 80024-0.

    CAS Статья PubMed Google ученый

  • 24.

    Jurstrand M, Christerson L, Klint M, Fredlund H, Unemo M, Herrmann B: Характеристика Chlamydia trachomatis с помощью ompA , секвенирование и мультилокусное типирование последовательностей в шведском округе до и после идентификации нового вариант. Половая трансмиссия. 2010, 86: 56-60. 10.1136 / sti.2009.037572.

    Артикул PubMed Google ученый

  • 25.

    Хорн М., Фриче Т.Р., Готон Р.К., Шлейфер К.Х., Вагнер М.: Новые бактериальные эндосимбионты Acanthamoeba spp. родственны симбионту Paramecium caudatum Caedibacter caryohilus . Environ Microbiol. 1999, 1: 357-367. 10.1046 / j.1462-2920.1999.00045.x.

    CAS Статья PubMed Google ученый

  • 26.

    Wilson IG: Ингибирование и облегчение амплификации нуклеиновых кислот. Appl Environ Microbiol. 1997, 63: 3741-3751.

    CAS PubMed PubMed Central Google ученый

  • 27.

    Magbanua JP, Goh BT, Michel CE, Aguirre-Andreasen A, Alexander S, Ushiro-Lumb I, Ison C, Lee H: Chlamydia trachomatis Вариант , не обнаруженный тестами амплификации нуклеиновых кислот на основе плазмиды: молекулярный характеристика и неэффективность однократной дозы азитромицина.Половая трансмиссия. 2007, 83: 339-343. 10.1136 / sti.2007.026435.

    Артикул PubMed PubMed Central Google ученый

  • 28.

    Skulnick M, Chua R, Simor AE, Low DE, Khosid HE, Fraser S, Lyons E, Legere EA, Kitching DA: Использование полимеразной цепной реакции для обнаружения Chlamydia trachomatis из эндоцервикальных и образцы мочи в бессимптомной популяции женщин с низкой распространенностью. Диагностика Microbiol Infect Dis.1994, 20: 195-201. 10.1016 / 0732-8893 (94)


    CAS Статья PubMed Google ученый

  • 29.

    Jurstrand M, Olcén P, Magnuson A, Jakobsson L, Fredlund H, Unemo M: Появление нового варианта Chlamydia trachomatis в определенной области Швеции до 2002 г. ?. Половая трансмиссия. 2010, 86: 337-341. 10.1136 / sti.2009.040196.

    Артикул PubMed Google ученый

  • 30.

    Ripa T, Nilsson PA: Штамм Chlamydia trachomatis с делецией 377 п.н. в криптической плазмиде, вызывающей ложноотрицательные тесты амплификации нуклеиновых кислот. Sex Transm Dis. 2007, 34: 255-256.

    PubMed Google ученый

  • 31.

    Стивенс М.П., ​​Тан С.Е., Хорват Л., Фэйрли К.К., Гарланд С.М., Табризи С.Н.: Отсутствие варианта Chlamydia trachomatis , несущего делецию в криптической плазмиде, у клиентов клиники инфекций, передающихся половым путем, и антенатальные пациенты в Мельбурне.Commun Dis Intell. 2008, 32: 77-81.

    Google ученый

  • 32.

    Kong F, Gilbert GL: Постгеномная таксономия уреаплазм человека — тематическое исследование, основанное на нескольких последовательностях генов. Int J Syst Evol Microbiol. 2004, 54: 1815-1821. 10.1099 / ijs.0.63073-0.

    CAS Статья PubMed Google ученый

  • 33.

    Monecke S, Helbig JH, Jacobs E: Фазовая вариация множественных полосчатых белков в Ureaplasma urealyticum и Ureaplasma parvum .Int J Med Microbiol. 2003, 293: 203-211. 10.1078 / 1438-4221-00239.

    CAS Статья PubMed Google ученый

  • 34.

    Zimmerman CU, Stiedl T, Rosengarten R, Spergser J: Альтернативные фазовые вариации в экспрессии двух основных поверхностных мембранных белков (MBA и UU376) серовара Ureaplasma parvum 3. FEMS Microbiol Lett. 2009, 292: 187-193. 10.1111 / j.1574-6968.2009.01505.x.

    CAS Статья PubMed Google ученый

  • 35.

    Teng LJ, Ho SW, Ho HN, Liaw SJ, Lai HC, Luh KT: быстрое обнаружение и дифференциация биоваров Ureaplasma urealyticum в клинических образцах с помощью ПЦР. J Form Med Assoc. 1995, 94: 396-400.

    CAS Google ученый

  • 36.

    Teng LJ, Zheng X, Glass JI, Watson HL, Tsai J, Cassell GH: Ureaplasma urealyticum Специфичность и разнообразие биовара кодируются в многополосном гене антигена. J Clin Microbiol.1994, 32: 1464-1469.

    CAS PubMed PubMed Central Google ученый

  • 37.

    Molano M, Meijer CJ, Weiderpass E, Arslan A, Posso H, Franceschi S, Ronderos M, Muñoz N, van den Brule AJV: Естественное течение инфекции Chlamydia trachomatis у бессимптомных колумбийских женщин: a 5-летнее наблюдение. J Infect Dis. 2005, 191: 907-916. 10.1086 / 428287.

    Артикул PubMed Google ученый

  • 38.

    Скотт Ламонтань Д., Бастер К., Эммет Л., Николс Т., Рэндалл С., Маклин Л., Мередит П., Хариндра В., Тобин Д. М., Андерхилл Г. С., Грэм Хьюитт В., Хопвуд Д., Глив Т., Гош А. К., Маллинсон Н., Дэвис А. Р. , Hughes G, Fenton KA: Заболеваемость и частота повторного инфицирования генитальной хламидийной инфекцией среди женщин в возрасте 16-24 лет, посещающих клиники общей практики, планирования семьи и мочеполовой медицины в Англии: проспективное когортное исследование, проведенное консультативной группой исследования отзыва хламидий . Половая трансмиссия.2007, 2007 (83): 292-303.

    Артикул Google ученый

  • 39.

    Эгглстон Э., Роджерс С.М., Тернер С.Ф., Миллер В.К., Роман А.М., Хоббс М.М., Эрбелдинг Э., Тан С., Вильярроэль М.А., Ганапати Л: Инфекция Chlamydia trachomatis среди детей в возрасте от 15 до 35 лет в Балтиморе, Мэриленд. Sex Transm Dis. 2011, 38: 743-749.

    PubMed PubMed Central Google ученый

  • 40.

    Regan DG, Wilson DP, Hocking JS: Охват — ключ к эффективному скринингу Chlamydia trachomatis в Австралии.J Infect Dis. 2008, 198: 349-358. 10.1086 / 589883.

    Артикул PubMed Google ученый

  • 41.

    Иши К., Сузуки Ф, Сайто А., Кубота Т.: Распространенность вируса папилломы человека, Chlamydia trachomatis, , и Neisseria gonorrhoeae, , у коммерческих секс-работников в Японии. Заражение Dis Obstet Gynecol. 2000, 8: 235-239.

    CAS PubMed PubMed Central Google ученый

  • 42.

    Tsunoe H, Tanaka M, Nakayama H, Sano M, Nakamura G, Shin T, Kanayama A, Kobayashi I, Mochida O, Kumazawa J, Naito S: высокая распространенность chlamydia trachomatis, neisseria gonorrhoeae и женщины, работающие в сфере коммерческого секса в Японии. Int J ЗППП, СПИД. 2000, 11: 790-794. 10.1258 / 09564620011.

    CAS Статья PubMed Google ученый

  • 43.

    Имаи Х., Шинохара Х., Накао Х., Цукино Х., Хамасуна Р., Като Т.: Распространенность и факторы риска бессимптомной хламидийной инфекции среди студентов в Японии.Int J ЗППП, СПИД. 2004, 15: 408-414. 10.1258 / 095646204774195272.

    Артикул PubMed Google ученый

  • 44.

    Hamasuna R, Imai H, Tsukino H, Jensen JS, Osada Y: Распространенность Mycoplasma genitalium среди студенток профессиональных школ Японии. Половая трансмиссия. 2008, 84: 303-305. 10.1136 / sti.2007.028670.

    CAS Статья PubMed Google ученый

  • 45.

    Yamada T, Atsuki Y, Wakasaya A, Kobayashi M, Hirano Y, Ohwada M: Характеристики пациентов с субхорионическими гематомами во втором триместре. J Obstet Gynaecol Res. 2012, 38: 180-184. 10.1111 / j.1447-0756.2011.01665.x.

    Артикул PubMed Google ученый

  • 46.

    Imai H, Nakao H, Shinohara H, Fujii Y, Tsukino H, Hamasuna R, Osada Y, Fukushima K, Inamori M, Ikenoue T, Katoh T: популяционное исследование бессимптомной инфекции Chlamydia trachomatis среди студентов женского и мужского пола.Int J ЗППП, СПИД. 2010, 21: 362-366. 10.1258 / ijsa.2010.010026.

    Артикул PubMed Google ученый

  • 47.

    Икехата М., Нумадзаки К., Чиба С. Анализ сероваров Chlamydia trachomatis в эндоцервикальных образцах, полученных от беременных японских женщин. FEMS Immunol Med Microbiol. 2000, 27: 35-41. 10.1111 / j.1574-695X.2000.tb01409.x.

    CAS Статья PubMed Google ученый

  • 48.

    De Francesco MA, Negrini R, Pinsi G, Peroni L, Manca N: Обнаружение биоваров Ureaplasma и подтип Ureaplasma parvum на основе полимеразной цепной реакции у женщин с симптомами генитальных инфекций или без них. Eur J Clin Microbiol Infect Dis. 2009, 28: 641-646. 10.1007 / s10096-008-0687-z.

    CAS Статья PubMed Google ученый

  • 49.

    McIver CJ, Rismanto N, Smith C, Naing ZW, Rayner B, Lusk MJ, Konecny ​​P, White PA, Rawlinson WD: Мультиплексное ПЦР-тестирование, обнаружение более высоких, чем ожидалось, показателей микоплазмы шейки матки, уреаплазмы, а также инфекции, вызываемые трихомонадой и вирусными возбудителями, у сексуально активных австралийских женщин.J Clin Microbiol. 2009, 47: 1358-1363. 10.1128 / JCM.01873-08.

    CAS Статья PubMed PubMed Central Google ученый

  • 50.

    Катаока С., Ямада Т., Чоу К., Нисида Р., Морикава М., Минами М., Ямада Н., Сакураги Н., Минаками Н.: Связь между преждевременными родами и колонизацией влагалища микоплазмами на ранних сроках беременности. J Clin Microbiol. 2006, 44: 51-55. 10.1128 / JCM.44.1.51-55.2006.

    Артикул PubMed PubMed Central Google ученый

  • 51.

    Cao X, Wang Y, Hu X, Qing H, Wang H: анализ полимеразной цепной реакции TaqMan в реальном времени для количественного обнаружения и дифференциации Ureaplasma urealyticum и Ureaplasma parvum . Диагностика Microbiol Infect Dis. 2007, 57: 373-378. 10.1016 / j.diagmicrobio.2006.09.006.

    CAS Статья PubMed Google ученый

  • 52.

    Экиэль А.М., Фридек Д.А., Романик М.К., Йужвяк Дж., Мартиросян Г.: Возникновение Ureaplasma parvum и Ureaplasma urealyticum у женщин с дисплазией шейки матки в Катовице, Польша.J Korean Med Sci. 2009, 24: 1177-1181. 10.3346 / jkms.2009.24.6.1177.

    Артикул PubMed PubMed Central Google ученый

  • 53.

    Grześko J, Elias M, Manowiec M, Gabryś MS: Заболеваемость генитальными микоплазмами и потенциальное влияние на фертильность человека. Med Wieku Rozwoj. 2006, 10: 985-992.

    PubMed Google ученый

  • 54.

    Viscardi RM: Ureaplasma разновидность: роль в болезнях недоношенных.Clin Perinatol. 2010, 37: 393-409. 10.1016 / j.clp.2009.12.003.

    Артикул PubMed PubMed Central Google ученый

  • 55.

    Hartmann M: Генитальные микоплазмы. J Dtsch Dermatol Ges. 2009, 7: 371-377.

    PubMed Google ученый

  • 56.

    Denks K, Spaeth EL, Jõers K, Randoja R, Talpsep T, Ustav M, Kurg R: Коинфекция Chlamydia trachomatis, Ureaplasma urealyticum и вируса папилломы человека среди пациентов, посещающих клиники ЗППП в Эстонии.Scand J Infect Dis. 2007, 39: 714-718. 10.1080 / 00365540701199824.

    Артикул PubMed Google ученый

  • 57.

    Хорнер П., Томас Б., Гилрой С.Б., Эггер М., Тейлор-Робинсон Д.: роль Mycoplasma genitalium и Ureaplasma urealyticum в остром и хроническом негонококковом уретрите. Clin Infect Dis. 2001, 32: 995-1003. 10.1086 / 319594.

    CAS Статья PubMed Google ученый

  • 58.

    Yokoi S, Maeda S, Kubota Y, Tamaki M, Mizutani K, Yasuda M, Ito S, Nakano M, Ehara H, Deguchi T. Роль Mycoplasma genitalium и Ureaplasma urealyticum уретокритокрит-биовар 2 в посттравматическом биоваре 2. Clin Infect Dis. 2007, 45: 866-871. 10.1086 / 521266.

    Артикул PubMed Google ученый

  • 59.

    Nelson DE, Virok DP, Wood H, Roshick C., Johnson RM, Whitmire WM, Crane DD, Steele-Mortimer O, Kari L, McClarty G, Caldwell HD: иммунное уклонение от IFN-гамма хламидий связано с тропизм инфекции хозяина.Proc Natl Acad Sci USA. 2005, 102: 10658-10663. 10.1073 / pnas.0504198102.

    CAS Статья PubMed PubMed Central Google ученый

  • 60.

    Моррисон Р.П .: Новое понимание постоянной проблемы — хламидийных инфекций. J Clin Invest. 2003, 111: 1647-1649.

    CAS Статья PubMed PubMed Central Google ученый

  • Ureaplasma Urealyticum и Parvum Test Online

    Что такое Ureaplasma Urealyticum / Parvum?

    Уреаплазма — это бактерия, которая может передаваться половым путем, хотя это не так. считается классической ИППП или ЗППП из-за низкой степени патогенности.Два виды — Parvum и Urealyticum.

    По оценкам, довольно большая часть сексуально активного населения инфицированы уреаплазмой, не вызывая при этом никаких проблем. Однако мы оспариваем претензии, зарегистрированные на некоторых веб-сайтах, что более 70% населения Великобритании имеют это инфекционное заболевание. Обработав тысячи образцов мочи и мазков на протяжении многих лет, Распространенность этой инфекции, по-видимому, не так широко распространена, как предполагает это утверждение.

    Симптомы уреаплазмы

    У большинства людей отсутствуют какие-либо симптомы, и нет никаких доказательств того, что Уреаплазма имеет долгосрочные последствия для здоровья бессимптомных людей. При наличии симптомов к ним относятся:

    • Чувство жжения при мочеиспускании
    • Раздражение уретры
    • Необычные выделения из влагалища у женщин
    • Выделения из уретры у мужчин

    Иногда мы сталкиваемся с пациентами женского пола, у которых были хронические цистит / инфекции мочевыводящих путей, при посеве каких-либо признаков бактериальные организмы.Когда мы проверяем мочу на уреаплазму с помощью ПЦР, мы затем найти его присутствующим; поэтому мы считаем, что уреаплазма может быть причастна к такие случаи.

    Стоит ли беспокоиться по поводу уреаплазмы?

    Как правило, мы советуем не беспокоиться об уреаплазме, хотя если инфекция вызывает внешние симптомы, мы рекомендуем курс антибиотики. Если у одного из партнеров есть симптомы, мы рекомендуем лечение другой партнер, поскольку бактерии могут передаваться половым путем.

    Вопрос о том, может ли уреаплазма вызывать долгосрочные проблемы, все еще не решен, но нет никаких реальных доказательств, подтверждающих некоторые из пугающих историй на Интернет. Мы рекомендуем вам не читать сайты, на которых нет медицинских поддержки, поскольку есть информация, которая не подтверждена эмпирическими данными.

    Могу ли я пройти тестирование на уреаплазму?

    Проверить на уреаплазму можно с помощью образца мочи или вагинального мазка.В образец мочи или мазок подвергается тесту ПЦР, который ищет ДНК бактерии. Пока бактерии присутствуют в образце мочи или тампоне. (что они будут, если вы инфицированы и возьмете образец в соответствии с указаниями), затем этот тест даст положительный результат. Результаты теста на уреаплазму в норме обработка займет 36 часов. Если у вас есть симптомы, мы рекомендуем более широкий экран. например, наш Полный экран ИППП, который проверяет 7 инфекций, которые могут вызывать те же симптомы как уреаплазма.

    Легко ли лечить уреаплазму?

    К счастью, в большинстве случаев уреаплазма легко поддается лечению. Если вы хотите пройти повторное тестирование, тогда мы рекомендуем подождать через 3-4 недели после завершения лечения — там есть риск получения ложноположительного результата, если вы проведете тестирование раньше. Некоторые люди продолжают испытывать симптомы исчезнут после того, как инфекция исчезнет, ​​но со временем эти симптомы исчезнут.

    Выявление биоваров уреаплазмы и определение подтипов Ureaplasma parvum среди женщин, обращающихся в университетскую больницу в Марокко

    Цели .Целью этого исследования было определение распространенности биоваров Ureaplasma и сероваров Ureaplasma parvum ( U. parvum ), связанных с ними факторов риска и симптомов, связанных с генитальными ИППП. Методы . ДНК, полученная из образцов шейки матки 1053 женщин, посещающих отделение акушерства и гинекологии и лабораторию патологической анатомии университетской больницы Хассана II в Фесе, Марокко, была использована для обнаружения биоваров Ureaplasma ( U.urealyticum и U. parvum ) и до подтипа U. parvum с помощью полимеразной цепной реакции (ПЦР). Результатов . Из 1053 обследованных женщин 25,4% (268/1053) имели уреаплазм, положительный результат. Частота U. urealyticum и U. parvum составила 12,1% (128/1053) и 7% (74/1053), соответственно, а совместное присутствие этих биоваров было отмечено в 6,3% (66/1053) случаев. . Подтип U. parvum выявил преобладание серовара 3/14 (61.4%). Связь демографических переменных с биоварами Ureaplasma была изучена и показала, что возраст («<30» лет), по-видимому, является фактором риска для Ureaplasma spp. и носительство U. urealyticum (OR 1,729, 95% CI [1,113–2,687] и OR 1,848, 95% CI [1,026–3,330], соответственно). Не было различий в распространенности типа Ureaplasma относительно симптомов. Однако значимая связь была обнаружена между сероваром 1 U. parvum и бесплодием (). Заключение . Это первое исследование, проведенное в Марокко, дает представление о биоварах Ureaplasma и сероварах U. parvum , циркулирующих в этом регионе, связанных с ними факторах риска и симптомах, связанных с генитальными ИППП. Следовательно, необходимы дальнейшие исследования для выяснения и подтверждения патогенной роли этих видов Ureaplasma .

    1. Введение

    Урогенитальная Уреаплазма относится к нормальной комменсальной флоре половых путей человека [1, 2].Однако он может быть патогенным, если его бактериальная нагрузка составляет ≥10 4 организмов на мл (инфекционная доза). Этот показатель обычно считается бременем, указывающим на инфекцию, которую необходимо лечить [2, 3]. Фактически, это может быть связано со многими гинекологическими или акушерскими патологиями, такими как негонококковый уретрит, воспалительные заболевания органов малого таза, преждевременные роды или поздние аборты и бесплодие [4].

    Человек Уреаплазма spp. включают два вида патогенов человека: Ureaplasma urealyticum ( U.urealyticum ) (биовар 2) и Ureaplasma parvum ( U. parvum ) (биовар 1). Специфическая идентификация каждого вида основана на молекулярных методах [5], и некоторые исследования показывают, что U. parvum встречается чаще, чем наиболее патогенный U. urealyticum [6]. Уровень колонизации у здоровых женщин составляет около 18–87% для U. parvum и около 6–10% для U. urealyticum [7].

    На основании биохимических и генетических характеристик [5], U.parvum (биовар parvo) разделен на четыре серовара (1, 3, 6 и 14), а U. urealyticum (биовар T960T) разделен на три подтипа. Подтип 1 включает серовары 2, 5, 8 и 9; подтип 2 включает серовары 4, 10, 12 и 13; а подтип 3 содержит серовары 7 и 11. Польское исследование показало, что инфекция верхних мочеполовых путей U. parvum чаще встречается у бесплодных женщин, чем у фертильных [2]. Некоторые исследования показывают, что патогенность Ureaplasma может зависеть от серотипа, а другие показали, что одни серотипы чаще связаны с синдромами, чем другие [8–10]. U. parvum серовар 3 наиболее часто обнаруживается у бесплодных женщин и мужчин, и некоторые исследования показали, что инфильтрация U. parvum сероваров 1, 3 и 6 вызвала морфологические изменения наружных гениталий у самок мышей. которые могут вызвать нарушения верхних половых путей, что может привести к бесплодию [11]. Однако серовар 6 U. parvum является вторым по распространенности (как у женщин, так и у мужчин) и связан с преждевременными родами [12–14].Это основная причина смерти детей в возрасте до пяти лет в развивающихся странах [15].

    В Марокко нет информации о распространенности биоваров Ureaplasma , распределении сероваров U. parvum и их связи с факторами риска и симптомами, связанными с инфекциями, передаваемыми половым путем (ИППП).

    Настоящее исследование направлено на определение распространенности биоваров Ureaplasma и сероваров U. parvum , связанных с ними факторов риска и симптомов, связанных с генитальными ИППП.

    2. Материалы и методы
    2.1. Пациенты и образцы

    Проспективное исследование проводилось с 2013 по 2015 год среди женщин, посещающих отделение акушерства и гинекологии и лабораторию патологической анатомии больницы Университета Хасана II в Фесе, Марокко, с целью определения распространенности бактериальных ИППП и характеристики видов. [16]. Все собранные образцы шейки матки были использованы для определения распространенности биоваров Ureaplasma и подтипа U.parvum . Доступны все демографические и клинические данные пациентов. Пациенты были разделены на две группы: бессимптомные женщины, пришедшие на гинекологический осмотр из-за планового осмотра, и женщины с симптомами, у которых был хотя бы один из следующих симптомов: бели, тазовая боль / диспареуния, зуд, меноррагия, метроррагия или дизурия. .

    2.2. Этика

    Исследование было одобрено Наблюдательным советом учреждения Феса, Марокко (№ 02/15), и все женщины получили письменное согласие.

    Ureaplasma Biovars Detection и U. parvum Subtyping

    U. urealyticum и U. parvum были обнаружены в образцах шейки матки с помощью ПЦР с использованием праймеров UreaA-B (F и R) и UMS-57 / UMA222 соответственно , как описано ранее [5, 17]. Образцы, которые были положительными на U. parvum , были дополнительно типированы, и их серовары были определены с использованием ранее описанной ПЦР, нацеленной на ген mba (многополосный антиген) [5].Используемые специфические пары праймеров, а также размер полученных продуктов описаны в таблице 1.

    Статистический анализ

    Статистический анализ выполняли с использованием программного обеспечения SPSS (версия 20). Различные корреляции были получены с использованием критериев хи-квадрат или точных критериев Фишера. Многофакторный анализ проводился с помощью бинарной логистической регрессии для определения факторов риска, включая все переменные в исходной модели.Результаты были выражены как отношение шансов (OR), 95% доверительный интервал (CI) и значения. Во всех тестах значение <0,05 считалось значимым.

    3. Результаты
    3.1. Описание исследуемой популяции

    Всего в это исследование были включены 1053 пациента. Набранные участники были в возрасте от 18 до 85 лет (средний возраст 42 года). Среди этих женщин 29% (302/1053) находятся в периоде менопаузы и 19% (197/1053) беременны. Из 1053 женщин, включенных в исследование, у 39% (409/1053) были симптомы, связанные с генитальными ИППП.Наиболее частыми симптомами были бели (32,3%; 132/409), тазовая боль / диспареуния (26,6%; 109/409), зуд (19,3%; 79/409), метроррагия (14%; 57/409), дизурия ( 4,6%; 19/409) и меноррагии (3,2%; 13/409). Более того, более половины (61%) (644/1053) участников не имели симптомов, связанных с генитальными ИППП. Социально-демографические и клинические характеристики исследуемой популяции представлены в Таблице 2.

    Виды Праймер (прямой и обратный) Последовательность (5–3) Размер (п. ATC TGC TCG TGA AGT ATT AC
    U.parvum UMS-57 (T / C) AA ATC TTA GTG TTC ATA TTT TTT AC 326/327 [5]
    У. parvum серовара 1 UMS83 TACTGATAGAAATTATGTAAGATTGC 398
    У. parvum серовар 6 UMS54 CTTAGTGTTCATATTTTTTACTAG 369
    U.parvum серовар 3/14 UMS125 GTATTTGCAATCTTTATATGTTTTCG 442
    UMA269 CTAAATGACCTT656565656565659154
    –50–50 94 94 94

    Переменная %

  • Сельский 212 20.5
    Городской 823 79,5
    Возраст (лет),
    <30 167 16
    > 50 256 24,5
    Нет 731 70,8
    Да 302 302.2
    Уровень образования,
    Неграмотные 657 63,3
    Грамотные 381 36,7
    Число беременностей 724 69,8
    > 4 313 30,2
    ≤4 832 80.2
    > 4 206 19,8
    Пассивное курение,
    Нет 785 76,1
    Нет 722 76,1
    Да 246 23,9
    Возраст при первом половом акте (лет), 9 9154 9154 63.6
    > 20 375 36,4
    Количество сексуальных партнеров в течение жизни,
    1 974 94,7
    Статус беременности
    Нет 856 81
    Да 197 19
    Наличие симптомов, связанных с генитальными ИППП 4 61
    Да 409 39
    Нет 1006 95.5
    Есть 47 4,5

    3.2. Распространенность и распределение
    уреаплазм, биоваров и U. parvum, сероваров

    Из 1053 обследованных женщин 25,4% (268/1053) имели уреаплазм, положительный результат. Доля U. urealyticum и U. parvum составляла 12,1% (128/1053) и 7% (74/1053), соответственно, и оба биовара присутствовали в 6.3% (66/1053) случаев. Учитывая смешанную инфекцию / колонизацию, распространенность U. urealyticum составляла 18% (194/1053), а распространенность U. parvum составляла 13% (140/1053).

    Типирование U. parvum показывает, что серовар 3/14 был наиболее частым (80/140, 57,1%), за ним следуют серовар 1 и серовар 6 (20%, 28/140 и 17,9%, 25 / 140 соответственно). Это распределение было другим, если рассматривать только беременных женщин. Таким образом, серовар 3/14 по-прежнему остается наиболее преобладающим (64.5%), затем серовар 6 (25,8%), а затем серовар 1 (9,7%) (рисунок 1).

    Наличие нескольких сероваров было отмечено в семи случаях 5% (7/140) с преобладанием двух сероваров в шести случаях 4,3% (6/140) [Два случая (серовар 1 и серовар 3/14), три случая (серовар 3/14 и серовар 6) и один случай (серовар 1 и серовар 6)] и один случай тройного серовара 0,7% (1/40). Эти коинфекционные / колонизационные серовары были обнаружены только у небеременных женщин.

    3.3. Факторы риска, связанные с
    Ureaplasma Biovars и U. parvum Serovars

    Для определения факторов риска, связанных с Ureaplasma биоварами и U. parvum сероварами, был проведен одномерный анализ, исключив смешанных случаев. U. urealyticum / U. parvum () и U. parvum серовары ().

    Переменные, используемые для этого анализа, включают социально-демографические факторы, историю болезни и сексуальное поведение.Результаты этого анализа представлены в таблице 3.

    944 944 944 9154 9154 944 944 11 (6,6) 0,544 9170 0,579 26.1) 915 915 0,449

    Характеристики Общее количество участников U. urealyticum (положительный) () U. parvum положительный) () U. urealyticum / U. parvum (положительный) () Ureaplasma spp. (положительный результат) ()

    Сельский 212 26 (12.3) 14 (6,6) 18 (8,5) 58 (27,4)
    Городской 823 100 (12,2) 59 (7,2) 48 (5,8) 207 ( 25,2)
    0,96 0,774 0,158 0,512
    Возрастная группа (лет) 16704
    16 (9.6) 54 (32,3)
    30-50 624 76 (12,2) 47 (7,5) 35 (5,6) 158 (25,3)
    > 50 254 24 (9,4) 16 (6,3) 15 (5,9) 55 (21,7)
    0,119 0,782 0,165 0,048 0,048
    Нет 731 97 (13.3) 49 (6,7) 49 (6,7) 195 (26,7)
    Да 302 29 (9,6) 22 (7,3) 17 (5,6) 68 ( 22,5)
    0,101 0,737 0,521 0,163
    Уровень образования
    42 (6.4) 169 (25,7)
    Грамотный 381 43 (11,3) 29 (7,6) 24 (6,3) 96 (25,2)
    0,953 0,851
    Количество беременностей
    ≤4 724 94 (13,0) 45 (6,29)
    > 4 313 32 (10,2) 28 (8,9) 16 (5,1) 76 (24,3)
    0,212 0,15 0,536
    ≤4 832 104 (12,5) 57 (6,9) 56 (6,7) 9154 915 4 206 22 (10.7) 16 (7,8) 10 (4,9) 48 (23,3)
    0,474 0,645 0,323 0,413
    0 9150 0 9150 0 0 91
    Нет 785 94 (12,0) 58 (7,4) 56 (7,1) 208 (26,5)
    Есть 246 31 (12,6) 31 (12,6) 10 (4.1) 56 (22,8)
    0,793 0,491 0,086 0,242
    Оральные контрацептивы
    52 (7,2) 48 (6,6) 189 (26,2)
    Да 308 37 (12,0) 21 (6,8) 18 (5,8) 76 (24,7)
    0.888 0,826 0,630 0,614
    Возраст на момент первого полового акта (лет)
    ≤20 656 84 (12,815) 36 (5,5) 167 (25,5)
    > 20 375 42 (11,2) 26 (6,9) 30 (8,0) 98 (26,1)
    0889 0.113 0,811
    Количество половых партнеров на протяжении всей жизни
    1 974 122 (12,5) 68 (7,0) 60 915,74 (6,2) 915
    ≥1 54 4 (7,4) 5 (9,3) 6 (11,1) 15 (27,8)
    0,264 0 .730

    значение, или точный критерий Фишера.

    Корреляция Ureaplasma биоваров и U. parvum сероваров с возрастом показывает, что Ureaplasma spp., U. urealyticum и U. parvum сыворотка. распространенность у женщин «моложе 30 лет». Однако U. parvum, серовар 6 был максимально обнаружен у женщин 30-50 лет, а U.parvum серовар 1 чаще встречался в возрастной группе «> 50» (рис. 2). Таким образом, одномерный анализ показывает значительную связь между Ureaplasma и возрастом «<30» () (Таблица 3).

    Все переменные со значением ≤ 0,2 были использованы в многомерном анализе, результаты представлены в таблице 4. Возраст («<30» лет), по-видимому, является фактором риска для Ureaplasma spp. и U. urealyticum носительство (OR 1,729, 95% ДИ [1.113-2,687] и OR 1,848, 95% ДИ [1,026-3,330], соответственно).

    50 9 .164. Корреляция между биоварами
    Ureaplasma и U. parvum сероварами и генитальными ИППП

    Для изучения корреляции между симптомами, связанными с генитальными ИППП, и биоварами Ureaplasma был проведен статистический анализ. Для этого анализа случаев уреаплазмы, отрицательных случаев и коинфекция Ureaplasma spp. с другими ИППП (вирусом папилломы человека, Chlamydia trachomatis , Neisseria gonororhea , Mycoplasma genitalium и Mycoplasma hominis ) были исключены.Таким образом, было рассмотрено только 87 случаев уреаплазмы (45 и 42 случая U. urealyticum и U. parvum соответственно). Результаты корреляции представлены в таблице 5. Таким образом, 36 женщин имели симптомы, связанные с генитальными ИППП, против 51 женщины без симптомов, и 5 женщин были бесплодными по сравнению с 82 женщинами фертильного возраста. U. urealyticum и U. parvum были равномерно распределены среди симптоматических и бессимптомных пациентов. Однако более высокая частота U.parvum наблюдалась у бесплодных женщин (таблица 5).

    43 spplasp1. 1.026 30-50

    Переменные Отношение шансов 95% ДИ значение

    Возраст (лет) <30 1,729 1,113-2,687 0,015
    30-50 1,227 0,865-1,739 0.251
    > 50 1
    U. urealyticum Возраст (лет) <30 1,848 915.344 1,329 0,819-2,157 0,249
    > 50 1

    Ureaplasma biovars
    U. urealyticum , 49 U.
    Симптомы, связанные с генитальными ИППП
    Да, 19 (52,8) 17 (47.2) 0,869
    Нет, 26 (51,0) 25 (49,0)
    Да, 2 (40154 2 (401544) 2 (401544) 915 0,591
    Нет, 43 (52,4) 39 (47,6)

    значение, или точный тест Фишера.

    Для определения корреляции между наличием генитальных симптомов, связанных с ИППП, и U.parvum сероваров, случаи с множественными сероварами () были исключены. Результаты представлены в таблице 6. Результаты показывают значительную связь между сероваром 1 U. parvum и бесплодием () (таблица 6).

    U. parvum серовар
    Серовар 1, Серовар 3/14, Серовар 9204 950
    Симптомы, связанные с генитальными ИППП
    Да, 1 (5.9) 15 (88,2) 1 (5,9)
    Нет, 5 (22,7) 15 (68,2) 2 (9,1)
    значение 0,144 0,713
    Да, 2 (66,7) 1 (33,3) 0 (0)
    Нет, 49 4 80,6) 3 (8,3)
    значение 0.011 0,066 0,607

    значение, или точный критерий Фишера.
    4. Обсуждение

    Уреаплазма spp. в основном располагается на слизистых поверхностях мочеполовых путей у взрослых или в дыхательных путях младенцев [18]. Эти виды могут быть причиной негонококкового уретрита и осложнений беременности. Их частота выше у женщин по сравнению с мужчинами [19], а их колонизация была связана с возрастом, низким социально-экономическим уровнем, множеством сексуальных партнеров, этнической принадлежностью и использованием оральных контрацептивов [20].

    Насколько нам известно, это первое исследование, проведенное в Марокко с целью определения распределения, распространенности биоваров Ureaplasma и циркулирующих сероваров U. parvum , а также их связи с факторами риска и генитальными органами. Симптомы, связанные с ИППП.

    Настоящее исследование показывает, что 25% женщин были носителями Ureaplasma spp. Этот показатель немного схож с показателем, полученным в итальянском исследовании (23%) [21], но ниже, чем показатель, полученный в хорватском исследовании (34%) [3] (Таблица 7).Тем не менее, в итальянском исследовании полученная распространенность представляет только случаи положительных результатов посева на Ureaplasma с бактериальной нагрузкой ≥10 4 КОЕ (случаи инфекции). Это может объяснить низкую скорость, полученную по сравнению с нашими результатами, когда обнаружение U. u realyticum было выполнено непосредственно с помощью ПЦР без количественного определения бактерий.

    Исследование, регион Исследовательская группа Распространенность% ()
    Уреаплазма spp. UU UP UU / UP SV UP
    SV 1 SV 3/14 SV 6 Несколько SV

    915 Наше исследование 1053: женщины P и NP 25,4 (268/1053) 12,1 (128/1053) 7 (74/1053) 6,3 (66/1053) 20 (28/140) 57,1 ( 80/140) 17,9 (25/140) 5 (7/140)
    [21]; Италия 806: женщины P и NP 23 (186/806) 14 (22/158) 86 (136/158) Нет 37 (50/136) 39 (53 / 136) 24 (33/136) Нет
    [3]; Хорватия 1370: женщины P и NP 34.4 (471/1370) 7,4 (18/244 × ) 92,6 (226/244 × ) Нет ND ND ND ND Наше исследование Марокко 856: женщины НП 24,3 (208/856) 11,6 (99/856) 6,8 (58/856) 6 (51/856) 26,6 29/109 60,6 (66 / 109) 15,6 (22/109) 6,4 (7/109)
    [22]; Бразилия 302: сексуально активные НП женщины 76.2 (230/302) 16,6 (50/302) 60,6 (183/302) 4,6 (14/302) 23,6 (37/156 ) 39,5 (62 / 156 ) 40,8 (64/156 ) 11,5 (18/156 )
    Наше исследование; Марокко 197: P женщины 30,5 (60/197) 14,7 (29/197) 8,1 (16/197) 7,6 (15/197) 9,7 (3/31) 64,5 (20/31) 25.8 (8/31) Нет
    [14]; Австралия 191: женщины 48 (91/191) 13 (25/191) 39 (74/191) ND 15,3 (11/72 #) SV3: 37,5 (27/72 # )
    SV14: 0 (0/72 # )
    43 (31/72 # )
    SV6.1: 1,4 (1/72 # )
    2,8 (2 / 72 # )
    [5]; Австралия 78: U из вагинальных мазков у P-женщин 78 Уреаплазма положительных 19.2 (15/78) 79,5 (62/78) 1,3 (1/78) 27 (17/63) 49 (31/63) 16 (10/63) 8 ( 5/63)
    [23]; США 169: U из вагинальных мазков у P-женщин 169 Уреаплазма положительных результатов 14 (24/169) 81 (137/169) 4 (7/169 ± ) (33/144) SV3: 59,7 (86/144)
    SV14: 4,2 (6/144)
    28,5 (41/144) ND

    P: ; НП: небеременные; UU: Ureaplasma urealyticum ; UP: Ureaplasma parvum ; SV: серовар; Н.Д .: не определено.Общий посев положителен только для Ureaplasma urealyticum. × Только 244 образца были успешно генотипированы на UU и UP. 76,2% (230/302) исследованных женщин были колонизированы молликутами. 27 U. parvum положительных результатов были отрицательными для всех четырех известных сероваров U. parvum . # Без усиления 1% (2/72). ± Отрицательный Уреаплазма spp. 1% (1/169).

    Что касается биоваров Ureaplasma , наши результаты показали преобладание U.urealyticum (18%; 194/1053) по сравнению с U. parvum (13%; 140/1053) (с учетом смешанной инфекции / колонизации). Это распределение кажется обратным по сравнению с тем, что сообщается в других географических регионах, таких как Италия и Хорватия [3, 21]. Результаты подтипа U. parvum показывают, что серовар 3/14 U. parvum был наиболее распространенным, за ним следуют серовары 1 и 6, соответственно. Подобное распределение наблюдалось в итальянском исследовании, даже если частота была другой [21] (таблица 7).Эта разница может быть объяснена популяцией и географическим положением исследуемых.

    В группе небеременных женщин и независимо от их репродуктивного статуса распространенность U. urealyticum и U. parvum составила 11,6% (99/856) и 6,8% (58/856), соответственно (за исключением случаев смешанного обнаружение). Это распределение и распространенность отличаются от результатов бразильского исследования, в котором была отмечена высокая распространенность U. parvum (60,6%) [22] (Таблица 7). Разница особенно заметна на U.parvum уровень распределения серовара и был отмечен [22], по сравнению с нашим результатом, самым низким уровнем серовара 1 и более высокими случаями коинфекции / колонизации [22] (Таблица 7). Это различие может быть связано с географическим регионом, размером выборки и сексуальной активностью.

    В группе беременных женщин U. urealyticum преобладает, чем U. parvum (14,7% (29/197) против 8,1% (16/197)), соответственно (и учитывая только простую инфекцию / колонизацию). ), обратно пропорционально результатам, полученным на австралийских женщинах [14] (Таблица 7).Различие было также получено в распределении типов U. parvum : даже если серовар 3/14 преобладает в обеих популяциях, серовар 1 в большей степени преобладает, чем серовар 6 в австралийском исследовании [5] (таблица 7). Тем не менее, наше распределение сероваров аналогично тому, которое недавно было получено в американском и другом австралийском исследованиях (где серовары 3 и 6 являются наиболее частыми) [14, 23] (Таблица 7). Это может вызвать вопрос об эпидемиологической эволюции или изменении распределения видов с течением времени.Тот факт, что в этих более поздних исследованиях серовар 6 был в значительной степени связан с преждевременными родами [14, 23], позволяет нам предположить, что беременные женщины из нашей серии, несущие серовар 6 (25,8%), вероятно, имели риск преждевременных родов. Таким образом, необходимо контролировать течение их беременности, чтобы проверить эту гипотезу и усилить программы скрининга на Ureaplasma для предотвращения осложнений.

    В нашем исследовании присутствие множественных сероваров U. parvum не было обнаружено в группе беременных женщин, тогда как оно было зарегистрировано в 8% и 2 случаях.8% случаев в австралийских исследованиях [5, 14] (Таблица 7). Это различие может быть связано с географическим положением и сексуальным поведением женщин, а также их партнеров.

    Была изучена корреляция между сероварами U. parvum и возрастом, и результаты показывают, что высокие уровни серовара 3/14 и серовара 6 U. parvum в основном были получены у молодых женщин «≤50 лет» (что может быть связано с сексуальной активностью), тогда как U. parvum s эровар 1 чаще встречается у женщин в возрасте «старше 50».По данным Iwasaka et al., Это может быть связано с гормональным статусом (менопаузой) этих женщин. который описал присутствие Ureaplasma spp. во влагалищной флоре 25% женщин в постменопаузе [24]. Фактически, менопауза может быть связана с атрофией влагалища, истончением стенки влагалища, сухостью и изменениями pH из-за недостатка эстрогена, факторов, которые могут влиять на половую функцию и способствовать инфекции / колонизации [25].

    Используя модели логистической регрессии, была получена значимая связь между возрастной группой «<30 лет» и Ureaplasma spp.(). Эти результаты не удивительны и подтверждают результаты предыдущих исследований [26, 27], а также тот факт, что генитальные микоплазмы связаны с сексуальной активностью. В нашей серии исследований большинство набранных пациентов заявили, что в течение жизни у них был только один сексуальный партнер (их муж), что связано с социально-культурным и религиозным контекстом. Таким образом, связь между сексуальным поведением и биоварами Ureaplasma не может быть проведена.

    Корреляция между Ureaplasma biovars и симптомами, связанными с генитальными ИППП, не обнаруживает никакой связи ни для U.parvum , ни для U. urealyticum . Эти результаты согласуются с результатами других исследований, проведенных в Австралии, Словении и Хорватии [3, 28, 29]. Однако итальянское исследование показало, что U. urealyticum и U. parvum серовар 3/14 были достоверно связаны с симптоматическими пациентами [21]. В нашем исследовании была получена значимая связь между сероваром 1 U. parvum и бесплодием (). Чтобы подтвердить эти данные, исследование большой популяции и уточнение Ureaplasma spp.молекулярная характеристика будет представлять интерес.

    У настоящего исследования были некоторые ограничения: во-первых, пациенты, участвующие в этом исследовании, могут не быть действительно репрезентативными для населения Марокко; Другими словами, данные, полученные из этого региона, могут не отражать ситуацию в других географических регионах, и требуются исследования в других регионах Марокко. Во-вторых, после последовательного набора пациентов размер выборки в группах бессимптомных и симптоматических женщин был разным.Аналогичным образом, культивирование и количественное определение Ureaplasma spp. не были выполнены. Следовательно, простую колонизацию нельзя отличить от инфекции. Однако нашей основной целью было определить распространенность биоваров Ureaplasma и сероваров U. parvum , связанных с ними факторов риска и симптомов, связанных с генитальными ИППП.

    5. Заключение

    В этом исследовании показано распределение и распространенность биоваров Ureaplasma, и каждого из U.parvum сероваров. Таким образом, результаты показали преобладание U. urealyticum по сравнению с U. parvum . Кроме того, подтип U. parvum показал, что серовар 3/14 является наиболее распространенным, за ним следуют серовары 1 и 6 и имеется значительная связь между сероваром 1 и бесплодием. Это позволяет говорить о необходимости тестирования этого вида при бесплодии.

    Полученные результаты дают представление о биоварах Ureaplasma, и U.Распространение сероваров parvum в Марокко и особенно в районе Феса, связанные с ними факторы риска и симптомы, связанные с генитальными ИППП. Необходимы дальнейшие исследования для выяснения и подтверждения патогенной роли этих видов.

    Доступность данных

    Данные, использованные для подтверждения выводов этого исследования, можно получить у соответствующего автора по запросу.

    Этическое одобрение

    Это исследование было одобрено институциональным наблюдательным советом Феса, Марокко (No.15.02).

    Конфликт интересов

    Авторы заявляют об отсутствии конфликта интересов в отношении публикации этой статьи.


    Мы хотели бы поблагодарить сотрудников отделения акушерства и гинекологии и лаборатории анатомо-патологии CHU Hassan II в Фесе за их помощь в клиническом обследовании и сборе образцов, соответственно.

    Тестирование и лечение уреаплазмы у женщин в Нью-Йорке — Тестирование на ЗППП в Нью-Йорке

    доктором.Алексей Штейншлюгер

    Если у вас есть вопросы, чтобы назначить консультацию, свяжитесь с нами или позвоните / текст: 1-646-663-4125.

    У нас отличные отзывы пациентов и их партнеров.

    Мы предлагаем доступное и высококачественное урологическое лечение со страховкой или без нее. Узнайте часы работы нашего офиса или как добраться до нашего офиса. Мы предлагаем рабочее время в будние, выходные и вечерние часы.

    Лечение уреаплазмы у женщин: что нужно знать

    Симптомы уреаплазмы у женщин

    До 15-50% процентов сексуально активных женщин имеют бессимптомную уреаплазму (бактерии присутствует, не вызывая явных симптомов).Уреаплазма может вызывать симптомы, когда она подавляет естественные защитные силы организма (иммунную систему). Общие симптомы , связанные с уреаплазмой у женщин :

    • Жжение или боль при мочеиспускании , боль в области таза и боль в уретре.
    • Раздражение уретры
    • выделения из влагалища
    • Проблемы с беременностью (многие женщины с необъяснимым бесплодием имеют Ureaplasma urealyticum) (ссылка)
    • Эндометрит (воспаление слизистой оболочки матки) с аномальной вагинальной болью, лихорадкой, лихорадкой выделения (ссылка)
    • Редко, могут также предрасполагать к образованию камней в почках (ссылка)

    Где пройти тест на уреаплазму в Нью-Йорке?

    В New York Urology Specialists мы предлагаем тестов на микоплазму и уреаплазму, а также лечение в тот же день для мужчин и женщин .

    Мы также проводим комплексное тестирование на ЗППП на другие инфекции. Мы предлагаем конфиденциальные встречи. Наши цены доступны со страховкой или без нее. Позвоните / напишите сегодня: 1-646-663-4125 или запишитесь на прием онлайн.

    Тест на уреаплазму у женщин : Как женщине пройти тест на уреаплазму?

    Исследование уреаплазмы у женщин проводится с помощью мазка из влагалища или мочи. Поскольку уровни обнаружения одинаковы для обоих, мазок больше не требуется, и для проведения теста берется образец мочи .

    Образец тестируется на инфекцию Ureaplasma либо с помощью посева, либо ДНК / РНК. Иногда при посеве можно пропустить потенциально серьезную инфекцию. В New York Urology Specialists мы проводим конфиденциальное тестирование ДНК / РНК на уреаплазму у женщин, потому что это более надежный тест. Анализ ПЦР (тестирование ДНК) высокочувствителен по сравнению с культурой с почти , на 80 процентов лучше у женщин (ссылка).

    Другие преимущества тестирования ДНК / РНК заключаются в том, что присутствие других микроорганизмов не влияет на тестирование уреаплазмы.Результаты тестов доступны на портале пациентов New York Urology Specialists в течение одной недели.

    Стоит отметить, что обнаружение уреаплазмы у женщин важно, так как у беременных инфекция может передаваться ребенку. Инфекция уреаплазмой у нерожденных младенцев и новорожденных связана с осложнениями , включая менингит, черепно-мозговую травму, пневмонию и повреждение легких.

    Важно знать, что другие инфекции, такие как бактериальный вагиноз (бактериальный вагиноз), Mycoplasma genitalium , хламидиоз и гонорея , более вероятно, чем уреаплазма.Уреаплазма, даже если она присутствует, не обязательно может быть причиной симптомов. Регулярное тестирование на ИППП рекомендуется для сексуально активных женщин.

    Является ли уреаплазма ЗППП?

    Уреаплазма классифицируется как заболевание, передающееся половым путем, , потому что, по всей видимости, она обычно передается половым путем.

    Важно понимать, что существует различных видов уреаплазм. : Ureaplasma parvum и Mycoplasma hominis не вызывают никаких симптомов и не требуют лечения. Ureaplasma urealyticum может вызывать уретрит у некоторых мужчин, тазовую боль и уретрит у женщин, а также предрасполагает к бесплодию.

    У многих людей уреаплазма присутствует в урогенитальных путях, но никогда не узнает об этом, потому что у них не возникает никаких симптомов. Эти бактерии составляют часть нормальной бактериальной популяции организма, живущих в равновесии с другими бактериями.

    Почему уреаплазма может вызывать серьезные симптомы у одного человека, но не у другого, не совсем ясно, но, вероятно, связано со способностью иммунной системы обнаруживать инфекцию и бороться с ней. Симптомы инфекции появляются, когда иммунная система не может контролировать количество бактерий уреаплазмы. .

    Уровень передачи уреаплазмы () не так высок (), как при других распространенных инфекциях, передающихся половым путем, таких как хламидиоз и гонорея. Однако стоит отметить, что смешанных инфекций распространены в половых путях . Одна инфекция, передающаяся половым путем, может предрасполагать человека к другой ИППП. Исследования показали, что наличие уреаплазмы оказывает значительное влияние на наличие хламидий у женщин .

    Безопасно ли лечить уреаплазму во время беременности?

    Беременные женщины с положительным результатом анализа на уреаплазма могут безопасно лечиться . Уреаплазма может передаваться от матери ребенку до рождения. Инфекции, вызванные этой бактерией, могут вызвать ряд осложнений во время беременности и могут представлять опасность для новорожденного. Инфекции микоплазмы связаны с выкидышем, преждевременным разрывом плодных оболочек, преждевременными родами и мертворождением.

    Новорожденные, особенно младенцы с массой тела менее 1000 граммов, подвергаются повышенному риску заражения уреаплазмой.Заражение этим агентом может вызвать пневмонию, проблемы с дыханием, повреждение легких, менингит и травму головного мозга у новорожденных (ссылка). Лечение уреаплазмы при беременности снижает вероятность осложнений у матери и ребенка. Антибиотики, используемые для лечения уреаплазмы (азитромицин и доксициклин), безопасны для использования во время беременности.

    Партнерское лечение уреаплазмы: нужны ли моему парню / девушке антибиотики от уреаплазмы?

    Во время лечения важно избегать вагинального, орального или анального секса или практиковать безопасный секс с презервативом.Если вы занимались незащищенным сексом до того, как инфекция полностью исчезла, ваш партнер может повторно заразить вас или вы можете передать инфекцию своему партнеру. Вот почему так важно, чтобы всех сексуальных партнеров проходили тестирование и проходили лечение одновременно .

    Наши опытные специалисты по уреаплазмам помогут найти партнера как для мужчин, так и для женщин. Вас и вашего партнера будут видеть отдельно, чтобы сохранить конфиденциальность. CDC рекомендует обследование и лечение всех сексуальных партнеров в течение предшествующих 60 дней.

    Что произойдет, если я оставлю уреаплазму без лечения? Излечима ли уреаплазма?

    Если уреаплазма не лечить, она может привести к ряду заболеваний и серьезным осложнениям, включая уретрит. Уреаплазма связана с бесплодием как у мужчин, так и у женщин. Беременные женщины подвержены риску выкидыша, преждевременных родов и мертворождения. Без лечения уреаплазма у женщин может распространяться из мочеполовых путей и вызывать воспалительные заболевания органов малого таза.

    Лечение уреаплазмы довольно простое.Курс антибиотиков обычно может вылечить уреаплазму. Поговорите с ведущими урологами в New York Urology Specialists сегодня, чтобы пройти обследование и пройти курс лечения от уреаплазмы.

    Уреаплазма — антибиотики не работают

    Антибиотики при уреаплазме могут не работать по нескольким причинам:

    • Пациент не прошел полный курс лечения антибиотиками .
    • Бактерии устойчивы к антибиотику , поэтому требуется другой препарат.
    • пациентов заразились повторно от полового партнера.

    Важно принимать антибиотики в соответствии с указаниями и пройти курс, чтобы полностью очистить организм от бактерий. И пациент, и его партнер должны проходить обследование и лечиться одновременно. Сексуальные партнеры должны воздерживаться от секса или использовать презервативы до тех пор, пока оба не дадут отрицательный результат на инфекцию уреаплазмой. .

    Если соответствие первоначальному режиму антибиотиков подтверждено и можно исключить повторное воздействие уреаплазмы при незащищенном половом акте, CDC рекомендует следующий режим для резистентной Ureaplasma urealyticum: метронидазол или тинидазол вместе с азитромицином.Урологи, прошедшие стажировку в New York Urology Specialists, имеют опыт лечения устойчивых инфекций уреаплазмы.

    Запись на прием для лечения уреаплазмы у женщин в отделении урологии Нью-Йорка

    Если у вас есть какие-либо вопросы о тестировании или лечении инфекций, передаваемых половым путем (ИППП), запишитесь на консультацию, свяжитесь с нами или позвоните по телефону 1-646-663-4125 .

    У нас отличные отзывы пациентов и их партнеров.

    Мы предлагаем доступное и качественное урологическое лечение со страховкой или без нее. Узнайте часы работы нашего офиса или как добраться до нашего офиса. Мы предлагаем рабочее время в будние, выходные и вечерние часы.

    ЗППП поддаются лечению почти у каждого мужчины и женщины

    Урологи New York Urology Specialists проходят специальную подготовку в области оценки и лечения инфекций, передаваемых половым путем (ИППП). Мы понимаем проблемы, которые такие ЗППП, как хламидиоз, герпес, гонорея и уреаплазма, создают для наших пациентов, их взаимоотношений и их самооценки. Мы поможем вам найти эффективное лечение ваших симптомов, которые могут быть вызваны ЗППП, ИМП или другой причиной.

    Урологи — это врачи, специализирующиеся на лечении инфекций у мужчин и женщин, вызванных заболеваниями, передающимися половым путем, а также инфекциями мочевого пузыря (ИМП). Благодаря нашему опыту и навыкам, мы можем предложить эффективный вариант лечения почти каждому мужчине и женщине с проблемами мочеиспускания и проблемами контроля мочевого пузыря.

    Мы лечим некоторые из самых сложных проблем ЗППП, в том числе:

    Назначьте встречу с доктором.Штейншлюгер:

    Позвоните / отправьте текст сегодня: 1-646-663-4125 или запишитесь на прием онлайн

    Д-р Алекс Штейншлюгер — уролог, прошедший стажировку, сертифицированный специалистами в области диагностики и лечения урологических проблем. у мужчин и женщин с применением современных эффективных и проверенных методов лечения. Его настоятельно рекомендуют ведущие врачи первичной медико-санитарной помощи в районе Нью-Йорка. Если вы или кто-то из ваших знакомых испытывает урологические симптомы, запишитесь на прием , чтобы воспользоваться услугой Dr.Консультации Штейншлюгера. Звоните по номеру , свяжитесь с нами по номеру , если у вас возникнут какие-либо вопросы.

    Если у вас есть вопросы, чтобы назначить консультацию, свяжитесь с нами или позвоните / отправьте текст: 1-646-663-4125.

    Мы предлагаем доступное и высококачественное урологическое лечение со страховкой или без нее. Узнайте часы работы нашего офиса или как добраться до нашего офиса. Мы предлагаем рабочее время в будние, выходные и вечерние часы.

    (PDF) Ureaplasma urealyticum и Ureaplasma parvum у женщин репродуктивного возраста

    отвечает на вопрос о симптомах мочеиспускания.Кроме того,

    возможно, что у некоторых из них были урогенитальные жалобы

    , связанные с симптомами атрофии влагалища или урогенией

    одновременно. Проблема в постмено

    паузальных женщинах состоит в том, чтобы отличить симптомы мочеиспускания от

    симптомов урогенитального старения.

    Частота НММП у наших пациентов была выше (58,8%,

    144/245) по сравнению с Hextall et al.


    , которые сообщили о

    распространенности ИМП, связанных с дефицитом эстрогена, в диапазоне

    от 20 до 30% в справочных материалах.

    Согласно нашим результатам, у большого процента из

    женщин (41,2%, 101/245) инфекция не была подтверждена микробиологически

    , несмотря на симптомы мочеиспускания. Кроме того,

    не было значимой разницы между женщинами с mi

    кробиологически подтвержденной инфекцией и женщинами с неподтвержденной инфекцией

    (58,8%, 144/245 против 41,2%, 101/245).

    Таким образом, микробиологический анализ необходим для индивидуальной обработки ap

    и предотвращения ненужного использования антибиотиков


    Вторая цель заключалась в оценке воздействия

    регулярности использования ГТ (включая системные и локальные

    дес) на LUTI. Согласно многочисленным исследованиям


    , одним из

    преимуществ ГТ является восстановление lactobacilli vagi

    nal флоры, связанной с защитным эффектом против uro

    генитальных инфекций.

    В нашем исследовании значительно более низкий процент LUTI

    был обнаружен у пользователей HT по сравнению с контрольной группой

    (46.9%, 67/143 против 75,5%, 77/102, p <0,001). Этот результат

    подчеркнул положительный эффект лечения ГТ на


    Хотя системная ЗГТ часто используется, роль пероральной гормональной терапии

    в уменьшении инфекций мочевыводящих путей неясна. Многие исследователи показали, что только

    местная ЗГТ снизила частоту НМП.


    .Количество перорального гормона, которое достигает

    слизистой оболочки влагалища, может быть слишком низким, чтобы повлиять на колонизацию



    . Наше исследование соответствует предыдущим

    ранее упомянутым исследованиям. Сравнивая локальное использование HT и системное использование

    , результат показал, что частота

    LUTI была значительно снижена у местных пользователей HT:

    по сравнению с системными пользователями (30,3%, 20/66 против 61,0%,

    47/77 , p <0.001) или даже по сравнению с контролем (30,3%,

    20/66 против 75,5%, 77/102, p <0,001). Хотя сравнение

    между системными пользователями HT и контрольной группой также имеет статистически значимое различие (61,0%, 47/77,

    по сравнению с 75,5%, 77/102, p = 0,049) , похоже, что локальное использование HT

    чаще ассоциировалось с уменьшением LUTI.

    Заместительные гормональные препараты должны применяться регулярно

    и строго назначаться в соответствии с предписаниями врачей

    .В исследовании Fistoni et al.


    , авторы

    сообщили о плохой стойкости при длительной ГТ в

    Хорватии. Согласно нашему исследованию, большинство из

    пациентов регулярно принимали ГТ (74,12%, 106/143). В

    re не было статистической разницы между локальными и системными группами HT

    в отношении регулярности использования HT (51,9%,

    55/106 против 48,1%, 51/106 p = 0,22) .

    В нашем исследовании регулярное употребление привело к снижению LUTI,

    как у местных, так и у системных пользователей HT.Более того, у постоянных

    местных пользователей HT был значительно более низкий процент

    LUTI, чем у системных регулярных пользователей HT (p = 0,003). Как

    когда-либо среди нерегулярных пользователей не было статистических различий между локальными и системными пользователями HT в отношении

    LUTI (p = 0,670).

    Возможная причина большого числа постоянных пользователей HT

    заключается в том, что в исследовании участвовали женщины из метрополии

    загребной области Загреба, где пациенты

    лучше информированы о преимуществах HT, имеют более высокое социальное положение. -eco

    Номинальный статус и лучший доступ к гинекологической практике.

    Тем не менее, возможно, что основным ограничением нашего исследования

    является обобщаемость данных из-за охвата

    протестированной популяции мегаполисов.

    В заключение, LUTI были микробиологически подтверждены

    у 58,8% (144/245) женщин в постменопаузе с отсутствующими симптомами uri-

    . Высокий процент пациентов с

    немикробиологически подтвержденными НМП (41,2%, 101/245)

    свидетельствует о значительной роли микробиологических тестов

    в диагностике НМП.Следовательно, микробиологический анализ

    необходим для соответствующего лечения и предотвращения ненужного использования антибиотиков

    . Частота НММП была на

    значительно ниже в обеих группах потребителей ЗГТ (локальная


    и системная), и подтвердила, что использование ЗГТ было связано

    со снижением НМП в популяции постмено

    паузально. женщины в Загребе.


    Авторы выражают благодарность госпоже В.Александра @ mega ~

    -Хорват за правку английского текста. Мы благодарим ap

    за участие в этом исследовании

    следующих коллег: С. Любин-Стернак, Загреб; З. Персич, Загреб;

    Дж. Чедид, Загреб.


    1. SCHAPERT SM, Национальное обследование амбулаторной медицинской помощи: 1992

    резюме. Расширенные данные из статистики естественного движения населения и здоровья, № 253, MD:

    Национальный центр статистики здравоохранения, публикация DHHS, Hyattsville,

    1994.- 2. РОНАЛЬД А.Р., Curr Opin Infect Dis, 8 (1995) 1. DOI: 10.1097 /

    00001432-199502000-00001. — 3. NYGAARD ​​IE, JOHNSON JM, Am

    Fam Physician, 53 (1996) 175. — 4. NICOLLE LE, J Antimicrob Che

    мать, 33 (1994) 99. — 5. [KERK V, [KERK V, JAK [I] J, KOLUMBI] —


    TAMBI] A, RADO [EVI] V, MARKOTI] A, BEGOVAC J, Coll Antropol,

    33 (2009) 625. — 6. Статистический ежегодник Республики Хорватия, 2001 г.

    Центральное статистическое бюро Республики Хорватия, Загреб, 2001. —

    7. RAZ R, STAMM WE, N Engl J Med, 329 (1993) 753. DOI: 10.1056 /




    Dis, 36 (2003) 1362.

    Добавить комментарий

    Ваш адрес email не будет опубликован.